ID: 1163727655

View in Genome Browser
Species Human (GRCh38)
Location 19:18931926-18931948
Sequence ACAGTTGCCCGGGCCAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163727644_1163727655 13 Left 1163727644 19:18931890-18931912 CCCAGGGCAGATGGGAACTGCCG 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1163727655 19:18931926-18931948 ACAGTTGCCCGGGCCAGGTGGGG 0: 1
1: 0
2: 1
3: 30
4: 336
1163727648_1163727655 -7 Left 1163727648 19:18931910-18931932 CCGAGGCGCGGTCTCCACAGTTG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1163727655 19:18931926-18931948 ACAGTTGCCCGGGCCAGGTGGGG 0: 1
1: 0
2: 1
3: 30
4: 336
1163727645_1163727655 12 Left 1163727645 19:18931891-18931913 CCAGGGCAGATGGGAACTGCCGA 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1163727655 19:18931926-18931948 ACAGTTGCCCGGGCCAGGTGGGG 0: 1
1: 0
2: 1
3: 30
4: 336
1163727643_1163727655 20 Left 1163727643 19:18931883-18931905 CCATGAACCCAGGGCAGATGGGA 0: 1
1: 0
2: 0
3: 18
4: 249
Right 1163727655 19:18931926-18931948 ACAGTTGCCCGGGCCAGGTGGGG 0: 1
1: 0
2: 1
3: 30
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163727655 Original CRISPR ACAGTTGCCCGGGCCAGGTG GGG Intronic
900404344 1:2485909-2485931 CAAGCTGCCCCGGCCAGGTGGGG - Intronic
900523949 1:3119436-3119458 ACAGCCGCCTGGGCCAGGTTGGG + Intronic
900617037 1:3570160-3570182 ACAGTCGGCTGGGACAGGTGTGG - Intronic
901639796 1:10687457-10687479 GCAGATGCCCCGGCCAGGAGTGG + Intronic
901644143 1:10707600-10707622 ACACCTGCCCTGGGCAGGTGGGG - Intronic
902682468 1:18053240-18053262 ACAGCTGCCCGAGCCACTTGGGG + Intergenic
903266318 1:22160172-22160194 AGAGTTGCCCGGGAAAGCTGCGG - Intergenic
904188722 1:28726498-28726520 ATAATTACACGGGCCAGGTGTGG - Intergenic
910968436 1:92830931-92830953 ACGGTAGCTCAGGCCAGGTGCGG - Intergenic
912384654 1:109265229-109265251 ACAGTTGCATGGGCCACATGTGG - Exonic
912957215 1:114163997-114164019 ACAGTTCCACGGGCCAAGTCAGG + Intergenic
913186866 1:116376441-116376463 AAAGTTGCCCGGGCCTGGCCGGG + Intronic
917320887 1:173780488-173780510 ACAGTAGCCAGGGCCAGGTGCGG + Intronic
917351699 1:174084565-174084587 AAATCTGCCAGGGCCAGGTGTGG - Intergenic
917983803 1:180294240-180294262 AAATTTGTCCTGGCCAGGTGCGG + Intronic
919156167 1:193768200-193768222 ATATTTGACCTGGCCAGGTGCGG - Intergenic
919402141 1:197131846-197131868 TGACTTGCCCTGGCCAGGTGTGG - Intronic
919759195 1:201086210-201086232 CGAGTTGCCCTGGTCAGGTGGGG + Intronic
919801609 1:201357785-201357807 CCACCTGCCAGGGCCAGGTGTGG + Intergenic
919857673 1:201716900-201716922 AGAGTTGGCAGGGCCAGGAGGGG + Intronic
920173523 1:204086106-204086128 GGAGTGGCCTGGGCCAGGTGTGG + Intronic
920243832 1:204573291-204573313 TCTGTGGCCTGGGCCAGGTGGGG + Intergenic
920716300 1:208343529-208343551 ACAGATGCCCAGGACAGGTCAGG - Intergenic
922412471 1:225389899-225389921 AAACTTGCCTGGGCCAGGTCTGG - Intronic
922952270 1:229569023-229569045 AAATTAGTCCGGGCCAGGTGCGG - Intergenic
923001092 1:230006965-230006987 ACAGTGGGCCTGGCAAGGTGAGG - Intergenic
923470509 1:234286380-234286402 ACAGTGGCTGGGGCCAGGGGCGG + Intronic
923707058 1:236352555-236352577 AAATTAGCCAGGGCCAGGTGTGG + Intronic
1063637153 10:7793400-7793422 ACAGATGGCAGGGCCAGGTGCGG - Intronic
1063895670 10:10678995-10679017 ACAATTCCCCTGGCCATGTGAGG - Intergenic
1070468106 10:76745322-76745344 TCAATTGCACTGGCCAGGTGTGG - Intergenic
1070730713 10:78826294-78826316 ACAGTTGCCATGGTGAGGTGGGG + Intergenic
1070762998 10:79036634-79036656 ACAGTTCCCTAGGCCAGGCGTGG - Intergenic
1072415142 10:95241059-95241081 ACAGCTTCCTGTGCCAGGTGAGG + Intronic
1074803785 10:117027786-117027808 AGAAATGCCTGGGCCAGGTGCGG - Intronic
1075806765 10:125194618-125194640 ACAGTTGCTCAGGCCGGGCGCGG - Intergenic
1076208407 10:128621897-128621919 AACTTTGCCCAGGCCAGGTGTGG - Intergenic
1076843131 10:133056367-133056389 ACAGGTGCTGGGGCCTGGTGTGG - Intergenic
1077174014 11:1180646-1180668 ACAGATGCCTGGGCCAGGACAGG - Intronic
1078102118 11:8336195-8336217 CAAGAGGCCCGGGCCAGGTGGGG - Intergenic
1078320861 11:10333312-10333334 AGAACTGCCTGGGCCAGGTGAGG - Intronic
1079045678 11:17100510-17100532 ACAGTGGCCTAGGCCAGGCGCGG - Intronic
1080146991 11:28997930-28997952 ACAGTTGCCAGGGCCTAGGGTGG + Intergenic
1081010891 11:37811637-37811659 ACAGGTGCCCGCTCCATGTGAGG + Intergenic
1081246588 11:40774017-40774039 ATAGTTGCCAGGGATAGGTGAGG - Intronic
1081489083 11:43553486-43553508 ACATCTGAACGGGCCAGGTGGGG + Intergenic
1081530843 11:43958309-43958331 CCAGTTGGCAGGTCCAGGTGGGG - Intergenic
1082075904 11:47975975-47975997 ACAGATTCCCTGGCCAGGTGTGG + Intergenic
1083768369 11:64853100-64853122 CCAGTGGCCCGGGCCAGTTCAGG - Exonic
1083985911 11:66215220-66215242 ATGGCTGCTCGGGCCAGGTGTGG - Intronic
1084656521 11:70522900-70522922 ACAGTTGCCCCGGCAACGTGCGG + Intronic
1084760282 11:71266442-71266464 ACTGTTGCCCCGCCCAGGTAGGG + Intergenic
1085061270 11:73449258-73449280 ACAGTAGCTTAGGCCAGGTGCGG - Intronic
1085093156 11:73736502-73736524 ACAGTTGGCCAGGCGCGGTGTGG + Intronic
1085430224 11:76441634-76441656 TCTGTTCCCCTGGCCAGGTGCGG - Intergenic
1085949355 11:81310659-81310681 ACAGTTTCCTAGGCCAGGCGTGG - Intergenic
1088890365 11:114039339-114039361 GCAGGTGACAGGGCCAGGTGGGG - Intergenic
1089157120 11:116410901-116410923 AAAGGTGGACGGGCCAGGTGTGG - Intergenic
1089243938 11:117104536-117104558 AATGTTGTCCTGGCCAGGTGTGG - Intergenic
1089466180 11:118687998-118688020 ACAGGAGCTGGGGCCAGGTGAGG + Intergenic
1089554565 11:119309259-119309281 ATACGTGCCGGGGCCAGGTGTGG - Exonic
1089727034 11:120490914-120490936 CCAGTGGTCCTGGCCAGGTGTGG - Intergenic
1090340309 11:126012697-126012719 TCAGTTGCCTTGGCCAGGTGCGG - Intronic
1091590386 12:1839195-1839217 ACCGAGGCCCTGGCCAGGTGAGG - Intronic
1092259782 12:6946631-6946653 ACAGTGGCCCAAGCCAGGTGAGG - Intronic
1093033156 12:14307771-14307793 CCAGTGCCCAGGGCCAGGTGCGG - Intergenic
1093704277 12:22257512-22257534 GCAGTTCCTGGGGCCAGGTGCGG - Intronic
1094612966 12:32011426-32011448 TAATTTGCCCAGGCCAGGTGCGG + Intergenic
1095699317 12:45174826-45174848 CCCGGTGCCCGGGCCCGGTGTGG + Intergenic
1096055538 12:48648306-48648328 AAAGTGTCCCGGGCCAGGTGCGG + Intergenic
1096273144 12:50182911-50182933 ATAGTTACATGGGCCAGGTGCGG + Intronic
1096373450 12:51087362-51087384 ACACTTCCCAGGGCCAGGCGTGG - Intergenic
1097884452 12:64714942-64714964 ACAGTTGCTGGGGTCATGTGAGG + Exonic
1098025445 12:66195945-66195967 AGAGTGGCCATGGCCAGGTGTGG - Intronic
1100601047 12:96111670-96111692 CAAGTTGTCGGGGCCAGGTGTGG - Intergenic
1101475080 12:105038055-105038077 ATAGGTGCCTGGGCCAGGTGAGG - Intronic
1102235352 12:111291153-111291175 ATAGTTGGCCAGGCCGGGTGCGG - Intronic
1103459066 12:121089483-121089505 GCAGCTGCCCTGGCCAGGTGGGG + Intergenic
1103709889 12:122904594-122904616 ACAGGAGCAGGGGCCAGGTGCGG - Intergenic
1106033995 13:26027493-26027515 ACAGTAACACTGGCCAGGTGTGG - Intergenic
1108602080 13:52003756-52003778 ACAGCTGCCTGCTCCAGGTGGGG - Intronic
1110771685 13:79356070-79356092 ACAGTGGCCTGGGCCAGGCATGG + Intronic
1111618502 13:90693004-90693026 ACAGATGTCCTGGCCAGGCGCGG - Intergenic
1112014998 13:95324310-95324332 GGAGTTGCCAGGGCCAGGTGAGG - Intergenic
1112351533 13:98639051-98639073 ACAGTGGAATGGGCCAGGTGTGG + Intergenic
1113423123 13:110185432-110185454 AAAGTAGCTGGGGCCAGGTGCGG - Intronic
1113678298 13:112223246-112223268 CCACTTCCCCGTGCCAGGTGAGG + Intergenic
1113947811 13:114054403-114054425 ACAGTCGCCCGCCCCAGGTTTGG - Intronic
1114163036 14:20190339-20190361 ACACTTGCCAGGCCCAGGAGAGG - Intergenic
1114384919 14:22244434-22244456 ACAGTTGGCCGCAGCAGGTGGGG - Intergenic
1114855532 14:26436324-26436346 AAAGTTTTCCTGGCCAGGTGCGG + Intergenic
1115225857 14:31101500-31101522 AAAATATCCCGGGCCAGGTGTGG + Intronic
1117418736 14:55522953-55522975 ACAGATGAATGGGCCAGGTGCGG + Intergenic
1118375821 14:65176084-65176106 AAAGTAGCTCTGGCCAGGTGGGG + Intergenic
1118445449 14:65847034-65847056 AAAATTTCCTGGGCCAGGTGTGG - Intergenic
1118956518 14:70488161-70488183 ACAGTTGCCTGGGGCAGGAGTGG - Intergenic
1119225076 14:72939061-72939083 AAAGTTGGCTGGGCCGGGTGTGG + Intronic
1119333170 14:73810584-73810606 ATAGTAGTCAGGGCCAGGTGTGG + Intergenic
1119723073 14:76904528-76904550 AGAGTGGCCCGTGGCAGGTGTGG + Intergenic
1119727080 14:76927923-76927945 AAAGTAGCAAGGGCCAGGTGTGG - Intergenic
1121236946 14:92398591-92398613 CCAGCAGCCCTGGCCAGGTGTGG - Intronic
1121335798 14:93076881-93076903 ACAGAGGCCCGGCCCAGGAGTGG - Intronic
1121752213 14:96366600-96366622 ATAATTACCCTGGCCAGGTGTGG + Intronic
1121936340 14:98022774-98022796 ACCTATGCCCGGTCCAGGTGGGG - Intergenic
1122892591 14:104739728-104739750 ACTGTCGGGCGGGCCAGGTGAGG - Exonic
1125013198 15:34903084-34903106 ACAGTTGCCCATGTCAGGTGAGG + Intronic
1125959403 15:43816533-43816555 ACAGTGCCCATGGCCAGGTGCGG - Intronic
1126766568 15:52016753-52016775 CCAGATCCCTGGGCCAGGTGTGG + Intronic
1127589737 15:60411278-60411300 ACAGTGGCTCTGGCCAGGAGTGG - Intergenic
1129047197 15:72746210-72746232 ATATTTGTCCAGGCCAGGTGTGG + Intergenic
1129160027 15:73742165-73742187 ACCATTGCCCAGGCCAGGAGTGG + Intronic
1129267957 15:74404086-74404108 ACAGCCGCCCGCGCCAAGTGGGG - Intergenic
1129849429 15:78783566-78783588 ACAGTTTCCTTGGCCAGGCGTGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130349037 15:83074293-83074315 GCAGGTGCTCGGGCCAGGCGTGG - Intergenic
1130410037 15:83639638-83639660 ACAGCTGCAAGGGCCAGCTGTGG + Intergenic
1130902178 15:88215355-88215377 ACAGTTATTGGGGCCAGGTGGGG - Intronic
1132481453 16:168248-168270 ACAGTTGCGGGGGCTGGGTGTGG - Intergenic
1132586498 16:707830-707852 AAAGTTGCCCGGCACAGGTGGGG - Intronic
1132602844 16:781660-781682 CCAGCTGCCTGGGCCAGGAGTGG + Intronic
1132676966 16:1124902-1124924 CCAGCTCCCCTGGCCAGGTGTGG + Intergenic
1134080362 16:11320661-11320683 ACCGGTCCCTGGGCCAGGTGCGG + Intronic
1134100110 16:11446113-11446135 AAAGTTCTCCTGGCCAGGTGTGG - Intronic
1134236963 16:12474147-12474169 TCACTTGCCCAGGGCAGGTGGGG - Intronic
1134298762 16:12970812-12970834 ACATATGCCCCGGCCAGGCGCGG - Intronic
1134797891 16:17058245-17058267 AAATTAGCCAGGGCCAGGTGCGG - Intergenic
1135397814 16:22144624-22144646 ACAATTGCCGAGGCCAGGTGCGG + Intronic
1137644673 16:50063652-50063674 ACAGTAGCCTAGGCCAGGCGTGG + Intergenic
1138345334 16:56316868-56316890 ACTGTGGCCAGGGCCAGGAGTGG + Intronic
1139776161 16:69318325-69318347 AGAGCAGCCCAGGCCAGGTGCGG - Intronic
1139850564 16:69949681-69949703 ACAGGTGGCTTGGCCAGGTGTGG + Intergenic
1139879548 16:70172593-70172615 ACAGGTGGCTCGGCCAGGTGTGG + Intergenic
1140372976 16:74422955-74422977 ACAGGTGGCTCGGCCAGGTGTGG - Intergenic
1142016091 16:87748476-87748498 ACAGAAGCCTGGGCCGGGTGTGG - Intronic
1142103224 16:88286553-88286575 GCAGGGGCCCAGGCCAGGTGAGG - Intergenic
1142426156 16:90003343-90003365 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426236 16:90003618-90003640 AAGGTAGCCCGGGCCAGGGGAGG - Intergenic
1142426270 16:90003728-90003750 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426287 16:90003783-90003805 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426358 16:90004003-90004025 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426393 16:90004113-90004135 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426410 16:90004168-90004190 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426427 16:90004223-90004245 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426444 16:90004278-90004300 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426461 16:90004333-90004355 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426478 16:90004388-90004410 AAGGTGGCCCGGGCCAGGGGAGG - Intergenic
1142426495 16:90004443-90004465 AAGGTAGCCCGGGCCAGGGGAGG - Intergenic
1142995319 17:3756693-3756715 AAAGTAGCTGGGGCCAGGTGTGG - Intronic
1144686432 17:17229042-17229064 ACAGTGGCCCAGGCCAGGCAGGG + Intronic
1144735921 17:17555447-17555469 ACAGTTTCCCCTGCAAGGTGAGG + Intronic
1144792862 17:17871078-17871100 TCAGAGGCCGGGGCCAGGTGTGG + Intronic
1145229706 17:21164534-21164556 GCAGTGGCCTCGGCCAGGTGCGG + Intronic
1145764865 17:27451633-27451655 GCGGTGGCCCAGGCCAGGTGGGG - Intergenic
1147018254 17:37509929-37509951 ACAGTTACCTGGGAAAGGTGGGG + Intronic
1147814524 17:43199363-43199385 AAAGCTACCCAGGCCAGGTGTGG - Intronic
1148155679 17:45424203-45424225 ACTGTTGCCTGAGCCGGGTGAGG - Intronic
1149867300 17:60157920-60157942 GCATGTCCCCGGGCCAGGTGGGG + Intronic
1150574745 17:66420297-66420319 ACATGTCCCCTGGCCAGGTGTGG - Intronic
1150757086 17:67924243-67924265 ACAGTGGCTCAGGCCGGGTGCGG - Intronic
1150964625 17:69953455-69953477 TCTGTTGCCCAGGCCAGGTTTGG + Intergenic
1151155492 17:72121186-72121208 ACAGCTGCCCGCTCCAAGTGGGG - Exonic
1151283968 17:73096521-73096543 AATGTTTCCTGGGCCAGGTGCGG + Intergenic
1151397558 17:73834005-73834027 TCGGTGGCCCTGGCCAGGTGGGG - Intergenic
1152400531 17:80063788-80063810 ATTGTTGACTGGGCCAGGTGCGG - Intronic
1152451452 17:80383785-80383807 ACACTTTTCCGGGGCAGGTGGGG - Exonic
1154199281 18:12288032-12288054 AGAGGTGCCCGGGCCAGGCAAGG + Intergenic
1156256994 18:35408343-35408365 TCAGATGCCCTGGCCAGGAGGGG - Intergenic
1157725318 18:49959477-49959499 ACAGCAGGCTGGGCCAGGTGAGG + Intronic
1160044705 18:75375905-75375927 ACACCTGCCTGTGCCAGGTGTGG - Intergenic
1161195788 19:2985783-2985805 AGAGTAGCTGGGGCCAGGTGTGG + Intronic
1161931204 19:7341592-7341614 AAAGATGCCTTGGCCAGGTGCGG - Intergenic
1162240371 19:9348216-9348238 ACTGTTGCCAGGGACAGGGGAGG + Intronic
1162596912 19:11636554-11636576 AAAGCTGCCAGGGCCAGGCGTGG + Intergenic
1162710027 19:12586008-12586030 ACAGTAGAACAGGCCAGGTGTGG + Intronic
1163392227 19:17037627-17037649 ACCGAGGCCCTGGCCAGGTGCGG + Intergenic
1163727655 19:18931926-18931948 ACAGTTGCCCGGGCCAGGTGGGG + Intronic
1164402078 19:27909627-27909649 GCAGGTGCCCGAGCCAGGCGTGG - Intergenic
1165357687 19:35313749-35313771 ACAGGCCCCAGGGCCAGGTGTGG - Exonic
1166548515 19:43649262-43649284 GCAGTTCTCAGGGCCAGGTGTGG + Intronic
1166694618 19:44845824-44845846 ACAGTTGCCTGAGGCACGTGGGG - Intergenic
1168052769 19:53841933-53841955 TCACTTGCCCAGGCCGGGTGCGG - Intergenic
926730817 2:16034289-16034311 TCAGTGGGCCGGGCCAGGTAGGG + Intergenic
931362422 2:61589202-61589224 AAAGATGTCCAGGCCAGGTGTGG - Intergenic
932458661 2:71866845-71866867 AGAATTGACCTGGCCAGGTGTGG - Intergenic
938237890 2:129721472-129721494 ACCGATGCCCGGGCCAGGCATGG + Intergenic
938707656 2:133946473-133946495 AAAGTTTCCCAGGCCAGGTGAGG + Intergenic
938726176 2:134110520-134110542 AATGTTGTCCAGGCCAGGTGTGG - Intergenic
940221727 2:151359676-151359698 TGAGTTCCCTGGGCCAGGTGCGG - Intronic
940417928 2:153443630-153443652 TCAATTTCCCAGGCCAGGTGCGG + Intergenic
943451988 2:188054849-188054871 AAAGATACCTGGGCCAGGTGTGG + Intergenic
946238416 2:218339798-218339820 AGAGGTACCCGAGCCAGGTGCGG - Exonic
947508382 2:230727946-230727968 AAACTAGCCCAGGCCAGGTGTGG + Intronic
947600689 2:231447906-231447928 AAGGTTGCTCTGGCCAGGTGTGG + Intergenic
948139455 2:235661784-235661806 ACAGGAGCCAGGGACAGGTGGGG + Intronic
948439578 2:237978156-237978178 AGGGTTGCCTGGGACAGGTGTGG + Intronic
948588541 2:239035850-239035872 TCAGTTCCCCAGGCCAGCTGTGG + Intergenic
948789619 2:240370504-240370526 AAAGTGGCCCAGGCCTGGTGAGG - Intergenic
948988786 2:241541502-241541524 ACGGGTGCCTGGGGCAGGTGGGG + Intergenic
949015526 2:241707580-241707602 ACATGTGCCCAGGCCGGGTGTGG - Intronic
1169845513 20:9987511-9987533 ACAATTGCCCTGGCCGGGCGCGG + Intronic
1170563532 20:17579282-17579304 GCAGTGGCACAGGCCAGGTGTGG + Intronic
1170681906 20:18533469-18533491 TCCTTTGCTCGGGCCAGGTGCGG - Intronic
1171185598 20:23121953-23121975 TCAGTTCCCCAGGACAGGTGGGG - Intergenic
1172440910 20:34965906-34965928 TCAGTTGGCAGGGCCAGGTCAGG + Intergenic
1173552987 20:43946332-43946354 GCAGTAGGCCTGGCCAGGTGTGG + Intronic
1173667603 20:44773974-44773996 ACAGTTGGCAAGGGCAGGTGTGG - Intronic
1173745164 20:45430944-45430966 CCAATAGCCTGGGCCAGGTGCGG - Intergenic
1174555648 20:51393678-51393700 CCAAATGCCCGGGGCAGGTGGGG + Intronic
1174566221 20:51466341-51466363 AGGGAGGCCCGGGCCAGGTGTGG - Intronic
1174881277 20:54281860-54281882 AATGTTGCCTAGGCCAGGTGCGG - Intergenic
1175218680 20:57404838-57404860 GCAGGTGCCAGGCCCAGGTGGGG + Intronic
1176413959 21:6464087-6464109 ACAGTTGCTTGGGCCGGGTGCGG + Intergenic
1178315484 21:31563146-31563168 AAAGATACCCAGGCCAGGTGCGG - Intergenic
1178417696 21:32417120-32417142 ACACTGGCCCAGGCCAGGTGGGG - Intronic
1179232518 21:39518082-39518104 TCATTTACCCGGGCCAGGTGTGG + Intergenic
1179504711 21:41832871-41832893 AGAGTTGTCCGGGACAGCTGGGG - Intronic
1179689457 21:43072409-43072431 ACAGTTGCTTGGGCCGGGTGCGG + Intronic
1179720291 21:43312765-43312787 ACAGGCGCGCTGGCCAGGTGAGG + Intergenic
1180682616 22:17638870-17638892 GCAGGGGCCAGGGCCAGGTGAGG + Exonic
1180720059 22:17901380-17901402 GCAGCAGCCTGGGCCAGGTGAGG + Intronic
1182303109 22:29349804-29349826 TCAGATCCCCAGGCCAGGTGTGG - Intronic
1182413255 22:30204735-30204757 AAAGCTGCCAGGGCCAGTTGGGG + Intergenic
1182533492 22:30981477-30981499 ACAGCTACCGGGGCCAGGGGCGG - Intergenic
1182704633 22:32269482-32269504 CCACGTGCCCGGGCCAGGTCTGG - Intergenic
1182724790 22:32435977-32435999 CCAGAAGCTCGGGCCAGGTGTGG + Intronic
1183378658 22:37479711-37479733 ACACTCGCCCTGGCCAGGTGTGG + Intronic
1184686626 22:46099246-46099268 ACCGTTGCCATGGCCAGGGGCGG + Intronic
949286529 3:2412541-2412563 ACTGTTGACTGGGCCGGGTGTGG - Intronic
949964254 3:9341787-9341809 TCAGTGGCCCAGGCCCGGTGCGG - Intronic
950218228 3:11174902-11174924 AATGTTGCCCGGGGCAGGAGTGG - Intronic
951197331 3:19839228-19839250 AGAATTGCTCAGGCCAGGTGCGG + Intergenic
953394251 3:42554628-42554650 AGAATTACCCAGGCCAGGTGTGG - Intronic
954391566 3:50270503-50270525 CCAGCTGCCCGGGCCGGGAGTGG + Intronic
954402532 3:50326516-50326538 ACATTTGCCATGCCCAGGTGTGG - Intronic
955323804 3:57994298-57994320 ACTGTTTCCCTGGCCAGGTGTGG + Intergenic
956801061 3:72758855-72758877 ATAGTAGCCTTGGCCAGGTGCGG - Intronic
958814678 3:98901960-98901982 ACAGGCGCCCGGGCCGGGCGGGG - Intergenic
958934913 3:100245911-100245933 ACTATTGGCCTGGCCAGGTGGGG - Intergenic
961254286 3:125534090-125534112 ACATTTACCAAGGCCAGGTGTGG + Intronic
961597512 3:128030260-128030282 ACAATAGCCATGGCCAGGTGTGG - Intergenic
962220418 3:133560199-133560221 ACAGTTTACAAGGCCAGGTGCGG + Intergenic
962834270 3:139172894-139172916 AAATTTTCCTGGGCCAGGTGTGG - Intronic
962974117 3:140431364-140431386 AAAGATGCCGGGCCCAGGTGTGG + Intronic
963366235 3:144338002-144338024 AAAGTTGTTGGGGCCAGGTGTGG - Intergenic
965143381 3:164867054-164867076 ACTGATGCTTGGGCCAGGTGCGG - Intergenic
965725548 3:171711457-171711479 ACAGTTTTCCTGGCCAGGTGCGG - Intronic
967094229 3:186163462-186163484 ACAGTTGCCATACCCAGGTGAGG - Intronic
967105848 3:186254515-186254537 ACAGTTGACCTGCCGAGGTGGGG - Intronic
967490026 3:190079674-190079696 ACAGTTGCTAGCCCCAGGTGTGG - Intronic
967735947 3:192952750-192952772 ACAGTTGGCTGGGCCAGGCATGG - Intergenic
968756564 4:2419017-2419039 GCAGTTTCCTGGGCCAGCTGGGG - Exonic
968821646 4:2857200-2857222 AAAATTGCCCTGGCCGGGTGTGG - Intronic
969102797 4:4782278-4782300 GCAGTTACCCAGGCCAGGGGTGG - Intergenic
969411100 4:7028713-7028735 ACTGATGCCTGGACCAGGTGTGG - Intronic
969689207 4:8694952-8694974 GCAGATTCCCGGGCCAGGAGGGG - Intergenic
970433489 4:16010789-16010811 AAAGTTTCCAGGGCCGGGTGTGG - Intronic
970514454 4:16814158-16814180 ACAGTATCCCTGGCCGGGTGCGG - Intronic
971482263 4:27125339-27125361 GCAGTTGCGGGGTCCAGGTGGGG - Intergenic
973616785 4:52686946-52686968 ACAATTGTCCAGACCAGGTGTGG + Intergenic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
976229149 4:82822681-82822703 AAAGTTAACCTGGCCAGGTGCGG + Intronic
976280817 4:83325454-83325476 ACAGACGCACAGGCCAGGTGTGG - Intronic
977096439 4:92750149-92750171 TGAGGCGCCCGGGCCAGGTGCGG - Intronic
978009966 4:103668555-103668577 ACAGTTGTTTCGGCCAGGTGTGG + Intronic
980057525 4:128093304-128093326 AAAGTTTTCCTGGCCAGGTGCGG + Intronic
980145711 4:128981522-128981544 ACGGTTGGCAGGTCCAGGTGGGG - Intronic
981122206 4:141065153-141065175 AGAATTGTCAGGGCCAGGTGTGG - Intronic
984250951 4:177333927-177333949 ACAGTTGCCTGGTCCAAGGGTGG - Intronic
985717577 5:1471341-1471363 ACAGCAGCCCGGGCCAGCTGTGG + Intronic
986690867 5:10312853-10312875 AGAAATACCCGGGCCAGGTGTGG + Intergenic
986722815 5:10572177-10572199 ACTGATGCCCTGGCCGGGTGTGG - Intronic
988171129 5:27657950-27657972 AAAGTTGCTAGGGCCAGGCGCGG + Intergenic
988665098 5:33318228-33318250 AGAGTTGCCCGAGCCTGGTCTGG - Intergenic
989641820 5:43590257-43590279 AGAGTTGGCCTGGCCAGGTGTGG - Intergenic
990378923 5:55202367-55202389 TCAGTAGCTGGGGCCAGGTGTGG + Intergenic
990573501 5:57102730-57102752 ACTATTGCCTGGGCCAGGTGTGG - Intergenic
990881221 5:60541359-60541381 TCAGTTGCCCTCACCAGGTGTGG + Intergenic
992464694 5:76992113-76992135 AAGGATGCCCAGGCCAGGTGCGG - Intergenic
993083112 5:83327209-83327231 GCAGTTGCCAGGGCTGGGTGTGG - Intronic
996885278 5:128346641-128346663 TCTGTTGCCCAGACCAGGTGTGG + Intronic
997910985 5:137873237-137873259 ACAGTAGGCTAGGCCAGGTGTGG + Intronic
998553348 5:143099293-143099315 ATAGCTGCCCTGGGCAGGTGGGG + Intronic
999256120 5:150210810-150210832 ACATGGGCCCGGGCCCGGTGTGG + Exonic
1000256094 5:159540130-159540152 ACAGATTTCAGGGCCAGGTGCGG + Intergenic
1002280993 5:178130125-178130147 AAAATTGGCCGGGCGAGGTGGGG - Intergenic
1002539775 5:179898737-179898759 ACAGTTTAAAGGGCCAGGTGTGG - Intronic
1002572915 5:180154193-180154215 ACAGTGCCCGGGGCCAGCTGAGG - Intronic
1003095462 6:3139695-3139717 ACAGTTCCCCGGGGCTGTTGTGG - Intronic
1004935786 6:20506879-20506901 AAAGTAGTCCTGGCCAGGTGTGG - Intergenic
1005610974 6:27524888-27524910 AGAGTTCACCGGGCCAGGCGCGG + Intergenic
1005716726 6:28556328-28556350 ATAATTTCCCTGGCCAGGTGTGG - Intergenic
1005986801 6:30880983-30881005 GCAGCTGCCCGGGCCAGCTGCGG - Intronic
1006559749 6:34900579-34900601 ACAGTTGTTATGGCCAGGTGTGG - Intronic
1006815244 6:36845523-36845545 ACAGATGCCAGGGCCAGGCAGGG - Intergenic
1007181812 6:39934249-39934271 ACAGCTTCCCGGGGCAGGAGTGG - Intronic
1007481263 6:42151640-42151662 GCAGTGGCTCAGGCCAGGTGCGG + Intergenic
1007546018 6:42695337-42695359 ACAGGTGCCCGGACGAGGAGGGG + Intergenic
1007623114 6:43226814-43226836 ACAGATTCCAGGGCCAGGCGCGG + Intronic
1008325352 6:50174494-50174516 TCAGTAGCCCAGGCCAGGCGTGG + Intergenic
1009741501 6:67752716-67752738 ACAGCAGCCGGGGCCAGGCGCGG - Intergenic
1009821461 6:68807387-68807409 AAAATTACCCGGGCAAGGTGGGG - Intronic
1009936074 6:70235822-70235844 ATACTTGACCAGGCCAGGTGCGG + Intronic
1011616334 6:89201487-89201509 ACTGATGCCTGGGCCGGGTGCGG + Intronic
1012255464 6:97026630-97026652 ATAGATGCCCAGTCCAGGTGTGG - Intronic
1012469554 6:99555730-99555752 AGAGTTGCACAGGCCAGGTATGG - Intronic
1013365918 6:109437858-109437880 GCAGTCAACCGGGCCAGGTGCGG - Intronic
1014797949 6:125747963-125747985 ACACTCGGCGGGGCCAGGTGGGG - Intronic
1015132334 6:129826973-129826995 ACAGTTGCTGTGGCCAGGCGTGG - Intergenic
1019094383 6:169567076-169567098 GCAGCAGCCCGAGCCAGGTGGGG + Intronic
1019485598 7:1287938-1287960 CCAGTTGCCCAGGCGTGGTGGGG - Intergenic
1020280442 7:6647517-6647539 AAAGTTGCACTGGCCGGGTGAGG + Intronic
1023943611 7:44786093-44786115 ACCGTTGGCCAGGCCAGGTGTGG - Intergenic
1023986765 7:45101533-45101555 CCAGTTGGCTGGGCAAGGTGAGG + Exonic
1024236850 7:47405350-47405372 ACAGTTGCCTGGGCCACCAGTGG - Intronic
1024911865 7:54455793-54455815 CCAGAAGCCTGGGCCAGGTGTGG - Intergenic
1025101245 7:56136882-56136904 ACAGTTGGCCAGGCCAGGCACGG - Intergenic
1026921015 7:74155433-74155455 ACACAAGCCCTGGCCAGGTGCGG - Intergenic
1027114663 7:75469386-75469408 AAAGTAGACCTGGCCAGGTGTGG - Intronic
1027218510 7:76199528-76199550 ACAGATGCACAGGCCAGGTGCGG + Intergenic
1029593519 7:101523357-101523379 AGAATTTCTCGGGCCAGGTGTGG - Intronic
1031370552 7:120959933-120959955 ATAGTTTGCCAGGCCAGGTGTGG - Intronic
1032458472 7:132092264-132092286 ACTGTTCACAGGGCCAGGTGTGG - Intergenic
1033243486 7:139700107-139700129 ACACTTGCCTGTGCGAGGTGGGG + Intronic
1034068976 7:148164381-148164403 ACAGCTGCCCTGGCTAGGTCAGG - Intronic
1034397382 7:150837510-150837532 ATATTTGCATGGGCCAGGTGCGG + Intronic
1034483149 7:151338859-151338881 AAAGGTGCCAGGGCCAGGTACGG - Intergenic
1034528301 7:151679772-151679794 AAACTAGCCCTGGCCAGGTGCGG + Intronic
1037948173 8:23002399-23002421 ACAGTTCTCTGGGCCAGGTGTGG + Intronic
1037995375 8:23348585-23348607 ACAGTGGCCTCGGCCGGGTGCGG + Intronic
1038328684 8:26591028-26591050 CCAGCTCCCAGGGCCAGGTGGGG - Intronic
1039877770 8:41602246-41602268 ACTGTGCCCCAGGCCAGGTGTGG - Intronic
1040525059 8:48215066-48215088 ACAGTGGTTCTGGCCAGGTGCGG + Intergenic
1040851978 8:51910214-51910236 ACAGTAGCCAGGGCCAGGCATGG + Intergenic
1040959541 8:53017753-53017775 ATAAATGTCCGGGCCAGGTGTGG + Intergenic
1044584754 8:93859201-93859223 CTAGTTACCCTGGCCAGGTGTGG + Intronic
1045047832 8:98295839-98295861 ATATTAGCCAGGGCCAGGTGTGG - Intergenic
1046613303 8:116448838-116448860 GCAGCTGCCTGGGCCAGGTCAGG + Intergenic
1047290106 8:123522497-123522519 AAAGTAACCAGGGCCAGGTGTGG - Intronic
1047600952 8:126425540-126425562 AAAACTGCCCTGGCCAGGTGTGG + Intergenic
1047981762 8:130190804-130190826 ACAGATGCATAGGCCAGGTGCGG - Intronic
1048160432 8:132015894-132015916 GCAGTTGCCAAGGCCTGGTGGGG - Intergenic
1048930202 8:139308850-139308872 ATACTTTCCCGGGCCAGGCGCGG - Intergenic
1049868526 8:144955721-144955743 ACAGTTGTGGGGGTCAGGTGTGG + Intergenic
1051195615 9:14560382-14560404 GCAGTTGCCAGGGGCTGGTGGGG + Intergenic
1051745161 9:20288476-20288498 ACAGTGGAAAGGGCCAGGTGCGG + Intergenic
1053522293 9:38792273-38792295 ATACTGGCCAGGGCCAGGTGTGG - Intergenic
1055075221 9:72207815-72207837 ACAATTGACTGGGCCAGGTGTGG + Intronic
1056634623 9:88321258-88321280 ACAAGTGCCCGGACCAGCTGAGG + Intergenic
1059046562 9:110875337-110875359 CCAATTGCCAGGGCAAGGTGGGG - Exonic
1059439309 9:114295935-114295957 TCAGTTGTCCAGGCCGGGTGTGG - Intronic
1061099419 9:128481178-128481200 ACAGTTTTTTGGGCCAGGTGTGG + Intronic
1061545437 9:131301650-131301672 ACAGCTTCCCGGGCCAGGCGGGG + Intronic
1061772531 9:132937151-132937173 GCAGGAGCCCAGGCCAGGTGTGG + Intronic
1061844735 9:133380874-133380896 ACAGTTGCCAGAGCCAAGAGAGG - Intronic
1062362667 9:136194981-136195003 ACTGTTCCCTTGGCCAGGTGCGG + Intergenic
1062404175 9:136386903-136386925 AAAGTTACCCGGGCATGGTGGGG - Intronic
1185560434 X:1056539-1056561 AAAATTAGCCGGGCCAGGTGCGG - Intergenic
1186693384 X:12003693-12003715 ATACTTGCCTGGGCCAGGAGCGG - Intergenic
1188164767 X:26848378-26848400 AGCGTTGCCTAGGCCAGGTGAGG + Intergenic
1189105361 X:38230084-38230106 GAAGTAGCCCAGGCCAGGTGCGG + Intronic
1189300789 X:39950876-39950898 AAAGTTTCCAGGGCTAGGTGTGG - Intergenic
1189314600 X:40045787-40045809 ACTGATGGCCCGGCCAGGTGCGG + Intergenic
1190247565 X:48700539-48700561 ACAATGACCAGGGCCAGGTGCGG + Exonic
1195234572 X:102883885-102883907 ACACTTCCCGGGGCCAGGAGGGG - Intergenic
1197969505 X:132100420-132100442 ACAGTCACCTTGGCCAGGTGCGG - Intronic
1198125662 X:133641183-133641205 AAAGATGTCCAGGCCAGGTGTGG + Intronic
1199487571 X:148364931-148364953 ACAGGTGGCAGGGCCGGGTGCGG - Intergenic
1201336673 Y:12888677-12888699 ACAATGGCCAGGGCCGGGTGCGG - Intergenic