ID: 1163730900

View in Genome Browser
Species Human (GRCh38)
Location 19:18948691-18948713
Sequence CCAAGGCCACAGAAGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163730900_1163730909 14 Left 1163730900 19:18948691-18948713 CCACGCTCCTTCTGTGGCCTTGG No data
Right 1163730909 19:18948728-18948750 GAACAGAGAGCAGAAGCCCGTGG No data
1163730900_1163730907 -8 Left 1163730900 19:18948691-18948713 CCACGCTCCTTCTGTGGCCTTGG No data
Right 1163730907 19:18948706-18948728 GGCCTTGGGGGAGCAGCTGTGGG No data
1163730900_1163730911 16 Left 1163730900 19:18948691-18948713 CCACGCTCCTTCTGTGGCCTTGG No data
Right 1163730911 19:18948730-18948752 ACAGAGAGCAGAAGCCCGTGGGG No data
1163730900_1163730910 15 Left 1163730900 19:18948691-18948713 CCACGCTCCTTCTGTGGCCTTGG No data
Right 1163730910 19:18948729-18948751 AACAGAGAGCAGAAGCCCGTGGG No data
1163730900_1163730912 20 Left 1163730900 19:18948691-18948713 CCACGCTCCTTCTGTGGCCTTGG No data
Right 1163730912 19:18948734-18948756 AGAGCAGAAGCCCGTGGGGAAGG No data
1163730900_1163730906 -9 Left 1163730900 19:18948691-18948713 CCACGCTCCTTCTGTGGCCTTGG No data
Right 1163730906 19:18948705-18948727 TGGCCTTGGGGGAGCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163730900 Original CRISPR CCAAGGCCACAGAAGGAGCG TGG (reversed) Intergenic
No off target data available for this crispr