ID: 1163734550

View in Genome Browser
Species Human (GRCh38)
Location 19:18971405-18971427
Sequence CAGGTGGGTTACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163734539_1163734550 27 Left 1163734539 19:18971355-18971377 CCAAGCATGGTGGCTCAGTCCTG No data
Right 1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG No data
1163734544_1163734550 0 Left 1163734544 19:18971382-18971404 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG No data
1163734546_1163734550 -1 Left 1163734546 19:18971383-18971405 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG No data
1163734542_1163734550 8 Left 1163734542 19:18971374-18971396 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163734550 Original CRISPR CAGGTGGGTTACCTGAAGTC AGG Intergenic
No off target data available for this crispr