ID: 1163737168

View in Genome Browser
Species Human (GRCh38)
Location 19:18988496-18988518
Sequence GTTCATGTGCCATCTAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163737168_1163737176 18 Left 1163737168 19:18988496-18988518 CCAAAGTTAGATGGCACATGAAC No data
Right 1163737176 19:18988537-18988559 AAGGTGAGGAGACCCTCAGGAGG No data
1163737168_1163737172 -9 Left 1163737168 19:18988496-18988518 CCAAAGTTAGATGGCACATGAAC No data
Right 1163737172 19:18988510-18988532 CACATGAACTGTGTGGAGGGAGG No data
1163737168_1163737173 -1 Left 1163737168 19:18988496-18988518 CCAAAGTTAGATGGCACATGAAC No data
Right 1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG No data
1163737168_1163737175 15 Left 1163737168 19:18988496-18988518 CCAAAGTTAGATGGCACATGAAC No data
Right 1163737175 19:18988534-18988556 AGCAAGGTGAGGAGACCCTCAGG No data
1163737168_1163737174 4 Left 1163737168 19:18988496-18988518 CCAAAGTTAGATGGCACATGAAC No data
Right 1163737174 19:18988523-18988545 TGGAGGGAGGCAGCAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163737168 Original CRISPR GTTCATGTGCCATCTAACTT TGG (reversed) Intergenic
No off target data available for this crispr