ID: 1163737174

View in Genome Browser
Species Human (GRCh38)
Location 19:18988523-18988545
Sequence TGGAGGGAGGCAGCAAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163737166_1163737174 6 Left 1163737166 19:18988494-18988516 CCCCAAAGTTAGATGGCACATGA No data
Right 1163737174 19:18988523-18988545 TGGAGGGAGGCAGCAAGGTGAGG No data
1163737167_1163737174 5 Left 1163737167 19:18988495-18988517 CCCAAAGTTAGATGGCACATGAA No data
Right 1163737174 19:18988523-18988545 TGGAGGGAGGCAGCAAGGTGAGG No data
1163737168_1163737174 4 Left 1163737168 19:18988496-18988518 CCAAAGTTAGATGGCACATGAAC No data
Right 1163737174 19:18988523-18988545 TGGAGGGAGGCAGCAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163737174 Original CRISPR TGGAGGGAGGCAGCAAGGTG AGG Intergenic
No off target data available for this crispr