ID: 1163741826

View in Genome Browser
Species Human (GRCh38)
Location 19:19019021-19019043
Sequence CTGATGGTATTGAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163741826_1163741835 26 Left 1163741826 19:19019021-19019043 CCCTCTGCTCTCAATACCATCAG 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1163741835 19:19019070-19019092 CATGAGAGGGATTCACAGCGTGG 0: 1
1: 0
2: 1
3: 11
4: 94
1163741826_1163741832 13 Left 1163741826 19:19019021-19019043 CCCTCTGCTCTCAATACCATCAG 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1163741832 19:19019057-19019079 TTGCCATATACTCCATGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1163741826_1163741831 12 Left 1163741826 19:19019021-19019043 CCCTCTGCTCTCAATACCATCAG 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1163741831 19:19019056-19019078 TTTGCCATATACTCCATGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163741826 Original CRISPR CTGATGGTATTGAGAGCAGA GGG (reversed) Intronic
903857987 1:26348210-26348232 CTGATGGTCTCCAGAGCACAGGG + Intronic
904472079 1:30742237-30742259 CTGCAGGTGGTGAGAGCAGATGG - Intronic
904767483 1:32861644-32861666 CTGTAGGTTTTGAAAGCAGAGGG - Intergenic
905234757 1:36538311-36538333 CTTAGGGGATTGAGATCAGAAGG + Intergenic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
908635554 1:66160126-66160148 CTTATGGTATTGTGATCAGAGGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910682204 1:89878551-89878573 CTCATTGTACTTAGAGCAGAAGG + Intronic
910725608 1:90335583-90335605 CTAATGGTGTTGAGAGCAAATGG + Intergenic
911824940 1:102470857-102470879 CTGATGGTTTTGTGAGCATCAGG - Intergenic
912419019 1:109530992-109531014 CTGAGGGTATAAATAGCAGAGGG - Intergenic
914816124 1:151063929-151063951 CTGATGATAATGAGAGCAAATGG - Intronic
914914808 1:151813122-151813144 CTTATTGTGTTTAGAGCAGAGGG + Intronic
915267392 1:154728815-154728837 CTGATGGGATTGAGAGAGGAAGG + Intronic
915464012 1:156085411-156085433 ATTATGGCAATGAGAGCAGAAGG + Intronic
916627737 1:166576853-166576875 CTAATGGTATTGAAATTAGATGG + Intergenic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918125828 1:181582587-181582609 CAGATGGTACTGAGAGGAGAAGG + Intronic
919668523 1:200317043-200317065 CTGATGTTATGGACAGCAGTGGG - Intergenic
923648885 1:235853258-235853280 CTGATGCTCTTTAGAGCTGAAGG - Intronic
1069826174 10:71256562-71256584 CTGAAGGCTCTGAGAGCAGATGG + Intronic
1070432933 10:76359419-76359441 CTGATGACATTCACAGCAGAGGG + Intronic
1079997615 11:27311603-27311625 CTGATGGAACTGAAAGCAGAAGG - Intergenic
1080761734 11:35257021-35257043 CTTTTGCTATTGAGAGCAAAGGG + Exonic
1090620738 11:128558884-128558906 AGGATGATATTGAGAGCACAAGG - Intronic
1090741898 11:129669726-129669748 CTGAAGGTAGAGAGACCAGATGG - Intergenic
1091236348 11:134024816-134024838 CTCATGTTGCTGAGAGCAGATGG - Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1098701434 12:73632796-73632818 CTGAAGGAATTCAGAGCTGACGG - Intergenic
1099481032 12:83166929-83166951 CTCAAGGTTTTGTGAGCAGAAGG + Intergenic
1099745216 12:86693124-86693146 CTGAAGGGATTGATAGCTGAAGG + Intronic
1100332013 12:93591788-93591810 AGTGTGGTATTGAGAGCAGACGG + Intergenic
1101504381 12:105332117-105332139 CTTATGCTAATGAGGGCAGACGG + Intronic
1101611314 12:106295012-106295034 CTCATGGAACTGAGACCAGAGGG + Intronic
1103020561 12:117530819-117530841 CTGATGGAGTTGGGGGCAGAGGG - Intronic
1104246825 12:127051085-127051107 CAGATGGTAATGAGAGCAATGGG - Intergenic
1105612231 13:21978332-21978354 GTGGTGGCATTGGGAGCAGATGG + Intergenic
1106279914 13:28257541-28257563 CAGATGGTAATGAGAGCAATGGG - Intronic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1107039798 13:35936746-35936768 CTGATGGATTTGAGGGCACAAGG + Intronic
1108361125 13:49668860-49668882 ATGTTGGTAGTGAGTGCAGATGG - Intronic
1109136468 13:58657175-58657197 CTTATACTATTGAGAGCAGTTGG - Intergenic
1109611013 13:64764595-64764617 CTGCATGTATTGAGAGCAGAGGG - Intergenic
1110015059 13:70389794-70389816 GTGATGGTATTAAGAGGTGAGGG + Intergenic
1110407032 13:75162262-75162284 CTGCTGTTATAGAGAGTAGAAGG + Intergenic
1110723487 13:78792398-78792420 CAGAATGTATTGAGAGCTGAAGG + Intergenic
1112631715 13:101168718-101168740 CTGATGGTATTGATGCCACAGGG - Intronic
1112732898 13:102386587-102386609 CTTTTGTTATTGAAAGCAGAAGG - Intronic
1114203579 14:20546691-20546713 ATGATAGTAATGAGAACAGAAGG + Intergenic
1116742172 14:48770183-48770205 AGGATGGGATTGAGGGCAGAAGG - Intergenic
1117070479 14:52051467-52051489 CTGATGGAATAGAAAGCACATGG - Intronic
1120255239 14:82110465-82110487 CTGTAGGTATTTAAAGCAGACGG + Intergenic
1121796156 14:96737096-96737118 CTGATGTTCATGTGAGCAGAAGG + Intergenic
1128047763 15:64634013-64634035 CTTATGGTATTGACAGCACAGGG + Intronic
1128774973 15:70313402-70313424 GTGATGGTATTAATGGCAGATGG - Intergenic
1132060279 15:98687006-98687028 CTGAAGGTTTTGAGAGGAGAGGG + Intronic
1133080160 16:3312263-3312285 CAGAAGGAATTGAGATCAGATGG + Intronic
1133813601 16:9179717-9179739 ATGGTGGGAGTGAGAGCAGAAGG + Intergenic
1133881096 16:9783103-9783125 CTGATGATATAGACATCAGAAGG - Intronic
1135091132 16:19518900-19518922 TTGATTGTTGTGAGAGCAGAGGG - Intronic
1135120038 16:19758054-19758076 CTTATGTTTGTGAGAGCAGAGGG - Intronic
1139834999 16:69831035-69831057 CCTATGGGATTGAGGGCAGAGGG + Intronic
1140423387 16:74840092-74840114 CTGATGGTTTTGGCAGCTGATGG - Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141222471 16:82083932-82083954 CTGATGGTACAAAGAGCAGTTGG + Intronic
1142761172 17:2042636-2042658 CTGGTGGTTTTCAGAGCAGGAGG + Exonic
1143987404 17:10926714-10926736 CTGATGCTACTGGGAGAAGAGGG - Intergenic
1144275410 17:13663527-13663549 CTGATGCTACAGAGAGCAGCTGG + Intergenic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145235011 17:21202145-21202167 CTGATGGACTTGAGACCAGAAGG - Intronic
1146733097 17:35212568-35212590 CTGAGGATATTGGAAGCAGAGGG + Intergenic
1149359958 17:55884784-55884806 GTGATGGTATTCAGAGGTGAGGG + Intergenic
1150869984 17:68896485-68896507 CGCATGGTATTCTGAGCAGATGG + Intronic
1150963136 17:69936786-69936808 CTGATGGCATTGGGAAGAGAGGG + Intergenic
1151750487 17:76034539-76034561 CAGATGGTGCTCAGAGCAGAGGG + Intergenic
1152044932 17:77929567-77929589 CTGCAGGTATTGAGGCCAGAAGG + Intergenic
1153163438 18:2235564-2235586 GTCTTGGTATTAAGAGCAGATGG + Intergenic
1154996220 18:21642637-21642659 GTGATGGTATTAAGAGGCGAGGG + Intergenic
1155329153 18:24697367-24697389 CTAATTGTATTTAAAGCAGATGG + Intergenic
1156027312 18:32669811-32669833 CTGATGGCAGTGACAGCAGTGGG + Intergenic
1156278757 18:35611674-35611696 CTCATGGTCTTGAGAGTGGAGGG + Intronic
1157145911 18:45162128-45162150 CTCATGGTATTGCAAGGAGATGG + Intergenic
1157653310 18:49359638-49359660 CTGTTAATATTGAGAGCAAAGGG - Intronic
1157866129 18:51186390-51186412 CAGATGGGAAGGAGAGCAGAGGG + Intronic
1159832425 18:73293718-73293740 CTCATGGCATAGAGAGTAGAAGG + Intergenic
1160082423 18:75741175-75741197 CTGTTGTTATTGTGAACAGAAGG - Intergenic
1160556765 18:79730593-79730615 CAAATGGTATTGAAAGCAGAAGG + Intronic
1161373420 19:3926597-3926619 CTGGTGGTATTTAGTGCTGAGGG + Exonic
1163581786 19:18143833-18143855 CTGATGGTATTCAGGAGAGATGG - Exonic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164585371 19:29467988-29468010 CTGCTGGTATGGAGAGCTAAAGG - Intergenic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167890663 19:52536698-52536720 CTGGTGGCAATGAGAACAGAGGG + Intronic
1168445360 19:56406965-56406987 CTGATGATACTGAGAGCTGCAGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
926416271 2:12652657-12652679 CTTATGGATTTGAGATCAGAGGG - Intergenic
927617876 2:24618460-24618482 CTGAAGGTCTTCAGACCAGATGG - Intronic
929550131 2:42885008-42885030 CTGCTGGTCTTGACAGCTGAAGG - Intergenic
931157824 2:59655354-59655376 CGGTGAGTATTGAGAGCAGAGGG - Intergenic
933812767 2:86043404-86043426 CCAATGGTCTTGGGAGCAGAGGG + Intronic
936242608 2:110800845-110800867 CAGATGTTGCTGAGAGCAGAGGG + Intronic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937204963 2:120230185-120230207 CTGCTTGTATTGATAGCAGCTGG + Intergenic
937576446 2:123428209-123428231 TTGATAGTCTTGAGGGCAGAAGG - Intergenic
937982951 2:127625595-127625617 CTCATGGTATACAGAGGAGATGG + Intronic
939088086 2:137745724-137745746 CTCATTGTAGTGAGAGCATATGG + Intergenic
939697028 2:145339350-145339372 ATTATGCTATTGTGAGCAGAAGG - Intergenic
941124821 2:161571966-161571988 TTGATGAAATTGAGAGAAGATGG - Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
944393724 2:199246326-199246348 ATGAAGTTACTGAGAGCAGAAGG - Intergenic
946490921 2:220148068-220148090 GAAATGGTACTGAGAGCAGAGGG + Intergenic
946493434 2:220171977-220171999 CTGCTGGTATTGGGGGCAGCAGG - Intergenic
946630337 2:221660336-221660358 CTGATGGGATTGAGTATAGAGGG - Intergenic
948357789 2:237393869-237393891 CTGGAAGTATTGAGAGCACACGG - Intronic
1169330518 20:4712645-4712667 CTGCTGGTATCAAGAGCTGATGG + Intergenic
1169355197 20:4899495-4899517 CAGAAGGCATTGAGCGCAGAAGG - Intronic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1171008035 20:21486961-21486983 ATAATGGTGTTGATAGCAGATGG + Intergenic
1172929696 20:38577178-38577200 CAGATGTTATTGTGAGCAGAAGG - Exonic
1173859069 20:46270235-46270257 CTGATGGTGCTGGGAACAGATGG + Intronic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1174554577 20:51384519-51384541 CTCATGGTATTAAGGGCAGAGGG + Intergenic
1175804294 20:61818893-61818915 CTGATGGCACAGAGAGCAGGGGG + Intronic
1180645841 22:17338008-17338030 CCGATGGAATTCAGAGGAGAAGG - Intergenic
1181324223 22:22032489-22032511 CTGCTGGTCTTGTGAGCAGGGGG - Intergenic
1182056494 22:27359524-27359546 CTGAGGGCAGTGAGAGGAGATGG + Intergenic
1184907653 22:47499647-47499669 CTGATGGGAATAGGAGCAGAGGG + Intergenic
950847841 3:16031975-16031997 CTGAAGGTATTGACAGCTGGAGG - Intergenic
951704723 3:25532383-25532405 CAGATGTTATTAACAGCAGAGGG + Intronic
952201268 3:31130623-31130645 TTGATAGATTTGAGAGCAGATGG + Intergenic
952951311 3:38527724-38527746 CTGAGGGTAAAGAGAACAGAAGG - Intronic
953786565 3:45915818-45915840 AGGATGGTAATGCGAGCAGAAGG - Intronic
955997961 3:64697039-64697061 CTGATTTTATTTAGAGGAGAAGG + Intergenic
956378319 3:68639286-68639308 CTCATGGTATTGCTAGCATATGG + Intergenic
956455050 3:69412433-69412455 CTAAAGTTAGTGAGAGCAGAGGG + Intronic
960785929 3:121372674-121372696 GGGAAGGCATTGAGAGCAGATGG - Intronic
960821524 3:121738270-121738292 CTGATGGGATTCTGAGAAGATGG + Intronic
965997201 3:174898287-174898309 CTCATGATATAGAGAGTAGAAGG + Intronic
968320285 3:197762110-197762132 GTGATGGTATTAACAGGAGAGGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
970696825 4:18687610-18687632 CTGATGGTATTTTGAGGAGCAGG - Intergenic
975577740 4:75879480-75879502 GAGATAGTATTGAAAGCAGAAGG - Intronic
975578580 4:75887059-75887081 GAGATAGTATTGAAAGCAGAAGG + Intronic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
976016397 4:80560285-80560307 CTGCTGGTATTCAGAGCCCAGGG - Intronic
978596069 4:110378976-110378998 GGGAAGGCATTGAGAGCAGATGG + Intronic
988722732 5:33894089-33894111 GTTATGGTCTTGAGAGTAGATGG - Intergenic
988826974 5:34947061-34947083 CTGATAGATTTAAGAGCAGACGG + Intronic
991119742 5:62998171-62998193 CTGATGGAGTTGACAGCACAGGG - Intergenic
992103248 5:73427516-73427538 ATGATGGTAAAGAGACCAGAAGG - Intergenic
992488523 5:77218537-77218559 CTGCAGTTATTTAGAGCAGAAGG + Intronic
993920374 5:93793977-93793999 CTGATGGGACTGACAGCTGAAGG + Intronic
994784048 5:104132867-104132889 GGGAAGGCATTGAGAGCAGATGG - Intergenic
996594809 5:125188160-125188182 CTGATGGTATTAGCAGCAGTGGG + Intergenic
998311060 5:141132647-141132669 ATGCTGGTAATGAGAGCAAAAGG + Intronic
1000543796 5:162573698-162573720 CTGAAGGTATTGTTTGCAGATGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1005152922 6:22773039-22773061 GTTATGGTGTTAAGAGCAGAGGG + Intergenic
1006786244 6:36669279-36669301 CTGATGGGAGGGGGAGCAGAAGG + Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007145288 6:39623625-39623647 CTGATGGTATTCAGACCAACTGG - Intronic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1008652241 6:53575320-53575342 CTGATGGTATTAGGAGGTGAGGG + Intronic
1010458054 6:76082022-76082044 CTGATGGTTTTGAAAGCATTTGG - Intergenic
1012660036 6:101876770-101876792 CTGATTGATTTGAGAACAGAAGG - Intronic
1013626624 6:111943985-111944007 CTGAGGGGGTTGAAAGCAGAAGG + Intergenic
1013668819 6:112376138-112376160 CTCCTGGTGTTGAGAGGAGAAGG + Intergenic
1013761597 6:113524824-113524846 CAGAGGGTAATGAGAGAAGAAGG + Intergenic
1014657578 6:124127609-124127631 CTGATGGTTTGGTGAGCAGAGGG + Intronic
1015551939 6:134420695-134420717 CAGATTGTATGCAGAGCAGAGGG - Intergenic
1018446128 6:163860607-163860629 GTGATGGGCTTGAGAGCTGAGGG + Intergenic
1018888535 6:167963028-167963050 TTGATGGTAAAGAGAGCAGATGG + Exonic
1021873336 7:25025651-25025673 CTGGTGGAATTGGGTGCAGAAGG + Intergenic
1022374584 7:29801662-29801684 CTTATGGGATGGGGAGCAGATGG - Intergenic
1024307244 7:47939099-47939121 CTGATGGTTCTGAGAACAGGAGG - Intronic
1025701552 7:63824895-63824917 CTCATGGTATTGTGGTCAGAAGG - Intergenic
1026170842 7:67952626-67952648 CTTATGGTGTTGTGATCAGAAGG - Intergenic
1028114065 7:86977518-86977540 GTTATGGTATTGAGAGTACAGGG - Intronic
1028347390 7:89799055-89799077 GGGATGGCATTGAGAGTAGATGG - Intergenic
1028790290 7:94845425-94845447 CTCATGGTAGTGAGATCTGATGG + Intergenic
1030007062 7:105130205-105130227 CTGTTGGGAATGAGAGCTGACGG - Intronic
1030607763 7:111656194-111656216 CTGCTGGTAGTGATATCAGAGGG + Intergenic
1032762489 7:134956822-134956844 CTCATGGTATTGATAGGTGATGG + Intronic
1032904426 7:136348015-136348037 CTGATGATACTGACAGCAGCAGG + Intergenic
1034029730 7:147747281-147747303 CTGATGTGATTGAGAGTGGAAGG - Intronic
1034336058 7:150324255-150324277 GTGCTGGAGTTGAGAGCAGAGGG + Intronic
1034840903 7:154395257-154395279 CTGATGGTATTAAGAGGTGAGGG - Intronic
1035176161 7:157052968-157052990 TTGGGGGTATTGGGAGCAGAGGG - Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036843836 8:12148202-12148224 CTGATGGTTTTAAGAGTAGGTGG - Intergenic
1037594810 8:20346051-20346073 CTGATGGCATTGAGAGCTTGTGG + Intergenic
1039842472 8:41303908-41303930 AGGATGGTATTGAAAGGAGAAGG - Intronic
1040028303 8:42801865-42801887 CTCGTGTTATTGAGAACAGAAGG + Intergenic
1041181815 8:55257067-55257089 GTGATGGTATTAAGAGATGAAGG - Intronic
1041669697 8:60479850-60479872 CTGAAGGGACTGACAGCAGAGGG + Intergenic
1042653518 8:71069432-71069454 CTGCGGGTATTCAGACCAGAAGG - Intergenic
1043651975 8:82607545-82607567 CTGTTGGGATTGAAAGCTGATGG - Intergenic
1043957562 8:86379044-86379066 ATGATGGTGTTAAAAGCAGAGGG - Intronic
1047027565 8:120840661-120840683 CTGGGACTATTGAGAGCAGAGGG + Intergenic
1048222683 8:132556546-132556568 CTGCTGTTTCTGAGAGCAGAAGG + Intergenic
1048300159 8:133245462-133245484 CTGATGTTATTAAAAGAAGAAGG + Intronic
1048674236 8:136759512-136759534 CTGACGGTCTTGAGACCAGTGGG + Intergenic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1049867034 8:144946015-144946037 CTGCTGATAGTGAGGGCAGATGG + Exonic
1050871297 9:10573584-10573606 AGGAAGGCATTGAGAGCAGATGG + Intronic
1052844250 9:33321152-33321174 CTGTTGGTGATGAGAGAAGAAGG + Intronic
1052892235 9:33712418-33712440 CTGAAGGTAGAGAGACCAGATGG - Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054764549 9:69032613-69032635 TTGATGGTGGTGAAAGCAGAGGG + Intergenic
1058351306 9:104027972-104027994 CTGATGACATTGAGAGCATCAGG - Intergenic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1060624246 9:125095986-125096008 CTGTTGGGAGTGAGAGCACAGGG - Intronic
1185996949 X:4962318-4962340 CTGTTTATATTGAGAGCAAAAGG - Intergenic
1186215216 X:7292761-7292783 CTGATGCAATTGCAAGCAGAGGG - Intronic
1186632622 X:11366384-11366406 CAGAAGGCATTGAAAGCAGAAGG + Intronic
1188535385 X:31190972-31190994 CTGAGGGTAGAGAGAGCAAAAGG + Intronic
1190063213 X:47223899-47223921 CAGACGGTGTTGAGAGAAGATGG - Intronic
1190623609 X:52313988-52314010 CTGAAAGTGTTAAGAGCAGATGG + Intergenic
1192231998 X:69271845-69271867 CTGAGAGTCTTGAGAGGAGAAGG - Intergenic
1192659807 X:73030375-73030397 GGGAAGGCATTGAGAGCAGATGG + Intergenic
1192996904 X:76521362-76521384 GGGAAGGCATTGAGAGCAGAGGG - Intergenic
1193370472 X:80691080-80691102 CTGATGGTATTGAGGTCAGTTGG + Exonic
1197264202 X:124348516-124348538 CTGAAGGTATTTTGGGCAGAAGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199136927 X:144265277-144265299 AAGAAGGCATTGAGAGCAGATGG + Intergenic