ID: 1163743919

View in Genome Browser
Species Human (GRCh38)
Location 19:19033608-19033630
Sequence GCGCGCTTGCGCAAGAGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163743919_1163743921 -6 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743921 19:19033625-19033647 GCGCGCTGTCCGCTTCTTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 35
1163743919_1163743928 30 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743928 19:19033661-19033683 GGCAAAACATTTCCCTGCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1163743919_1163743927 29 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743927 19:19033660-19033682 AGGCAAAACATTTCCCTGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 176
1163743919_1163743925 9 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743925 19:19033640-19033662 CTTCTGGGCGGACGCTCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 87
1163743919_1163743924 6 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743924 19:19033637-19033659 CTTCTTCTGGGCGGACGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1163743919_1163743920 -7 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743920 19:19033624-19033646 AGCGCGCTGTCCGCTTCTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 35
1163743919_1163743922 -3 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743922 19:19033628-19033650 CGCTGTCCGCTTCTTCTGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1163743919_1163743926 28 Left 1163743919 19:19033608-19033630 CCGGCTCTCTTGCGCAAGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1163743926 19:19033659-19033681 GAGGCAAAACATTTCCCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163743919 Original CRISPR GCGCGCTTGCGCAAGAGAGC CGG (reversed) Exonic