ID: 1163745159

View in Genome Browser
Species Human (GRCh38)
Location 19:19042506-19042528
Sequence CTGCAAATACAGAAGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 390}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163745159_1163745165 -4 Left 1163745159 19:19042506-19042528 CCCGGCCTCTTCTGTATTTGCAG 0: 1
1: 0
2: 0
3: 27
4: 390
Right 1163745165 19:19042525-19042547 GCAGAAGTTCTAGGGAAGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1163745159_1163745164 -5 Left 1163745159 19:19042506-19042528 CCCGGCCTCTTCTGTATTTGCAG 0: 1
1: 0
2: 0
3: 27
4: 390
Right 1163745164 19:19042524-19042546 TGCAGAAGTTCTAGGGAAGTAGG 0: 1
1: 0
2: 1
3: 25
4: 218
1163745159_1163745170 26 Left 1163745159 19:19042506-19042528 CCCGGCCTCTTCTGTATTTGCAG 0: 1
1: 0
2: 0
3: 27
4: 390
Right 1163745170 19:19042555-19042577 CCTTTCCTGTGATAACAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 149
1163745159_1163745166 22 Left 1163745159 19:19042506-19042528 CCCGGCCTCTTCTGTATTTGCAG 0: 1
1: 0
2: 0
3: 27
4: 390
Right 1163745166 19:19042551-19042573 TCACCCTTTCCTGTGATAACAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1163745159_1163745168 25 Left 1163745159 19:19042506-19042528 CCCGGCCTCTTCTGTATTTGCAG 0: 1
1: 0
2: 0
3: 27
4: 390
Right 1163745168 19:19042554-19042576 CCCTTTCCTGTGATAACAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163745159 Original CRISPR CTGCAAATACAGAAGAGGCC GGG (reversed) Intronic
900202983 1:1419626-1419648 CTGCGGGGACAGAAGAGGCCTGG - Intronic
901234587 1:7661157-7661179 GTGCAGATGCAGGAGAGGCCAGG - Intronic
901390336 1:8941610-8941632 CTGAAAATACAAAAGTAGCCAGG - Intergenic
901649457 1:10735376-10735398 CTGCAAACGCAGGCGAGGCCCGG + Intronic
902831325 1:19014879-19014901 CTTCAAATAGGGAAGAGGACTGG - Intergenic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
903953894 1:27012077-27012099 CTGCAAGGACAAAAGACGCCAGG - Intronic
904076525 1:27847005-27847027 CTGCAAAAAGAGAAGAGGGCAGG - Intronic
904119508 1:28188014-28188036 CTGAAAATACAAAAATGGCCGGG + Intronic
904628786 1:31825651-31825673 ATGAAAAAACACAAGAGGCCGGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905270111 1:36782142-36782164 CTGCAAGCTCAGAAGAGGACCGG - Intergenic
905590123 1:39156168-39156190 CTAAAAATACAAAATAGGCCAGG - Intronic
905659037 1:39706515-39706537 CTGCATATACAAAATAGGCCAGG - Intronic
905884462 1:41484373-41484395 CTGCAAATACAGAGGTGCCCAGG - Intronic
906247307 1:44285499-44285521 TTTCAGATAGAGAAGAGGCCAGG + Intronic
906260642 1:44386062-44386084 TTAAAAATATAGAAGAGGCCGGG - Intergenic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
907476348 1:54708488-54708510 CTGCAAATACTGCAGGAGCCAGG + Intronic
907487022 1:54785427-54785449 GTGCCAATCCAGAAGAGGCTGGG + Intronic
907492804 1:54819664-54819686 CTTCAAAAACAGGTGAGGCCGGG - Intronic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
909925151 1:81430052-81430074 CTGAAAATACAAAATAAGCCAGG - Intronic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
910973844 1:92885111-92885133 GTCCAAATACTGAAGAGACCAGG + Intronic
912642155 1:111357393-111357415 CAGCAAAGACAAGAGAGGCCAGG - Intergenic
913228852 1:116724310-116724332 GAGCAAAAACAAAAGAGGCCTGG + Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
915311024 1:155005864-155005886 TTGCCAACACAGAAGCGGCCAGG + Intronic
917576545 1:176327437-176327459 CTACAAATAAAGATGAGCCCTGG + Intergenic
919208838 1:194453763-194453785 CTTCATAGACAGAAGAGTCCAGG - Intergenic
919659142 1:200226449-200226471 CAGCAGATAAAGAAAAGGCCCGG + Intergenic
919915650 1:202137464-202137486 CTAAAAATACAAAAGTGGCCAGG + Intronic
920137395 1:203781029-203781051 CTACAAATACAGAATTAGCCGGG + Intergenic
920324200 1:205149061-205149083 CTAAAAATACAAAATAGGCCGGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920738826 1:208560693-208560715 CTGCAAAAATAGAGGATGCCTGG - Intergenic
921084737 1:211778450-211778472 CTGCATAGACAGAACAGCCCTGG - Intronic
921163014 1:212486318-212486340 CTGCAAATAGACCAGATGCCTGG - Intergenic
921205908 1:212848597-212848619 CTCAAAAAACAAAAGAGGCCAGG - Intergenic
922273959 1:224059271-224059293 CTGAAAATAGAGAAGAGGAAAGG + Intergenic
922371833 1:224918995-224919017 CTCAAAATTCAGAAGAAGCCAGG - Intronic
922699079 1:227747686-227747708 CTTCAGAGGCAGAAGAGGCCTGG + Exonic
923653572 1:235896488-235896510 CAAGAATTACAGAAGAGGCCGGG + Intergenic
924355602 1:243171971-243171993 CTGCAAATACAGTACAGCCCGGG - Intronic
924509213 1:244714837-244714859 CTTGAAAGACAGATGAGGCCAGG + Intergenic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
924919237 1:248609604-248609626 CTGCAAGAATAGAAGAGCCCAGG + Intergenic
1063841829 10:10081218-10081240 CTGAAAATACAAAAGTAGCCGGG - Intergenic
1065021781 10:21507825-21507847 CTGCAAAGAAGGAAGAGGCAGGG + Intergenic
1065378619 10:25066857-25066879 CTAAAAATACAAAAGTGGCCAGG + Intergenic
1066459363 10:35599678-35599700 CTTCAGAAACAGCAGAGGCCGGG - Intergenic
1066550912 10:36555770-36555792 CTGTAAAACCAGAAGAGGTCAGG + Intergenic
1067838684 10:49658218-49658240 CTAAAAATACAAAAAAGGCCAGG + Intronic
1068273071 10:54755091-54755113 CTGAAAATACAAAATAAGCCAGG - Intronic
1069013143 10:63397372-63397394 CTGAAAATACAAAATAAGCCGGG - Intronic
1069495104 10:68896753-68896775 CTAAAAATACAAAATAGGCCCGG - Intergenic
1069837473 10:71318543-71318565 CTGAAAATACAAAAGTAGCCGGG - Intergenic
1070842579 10:79497515-79497537 CTGCAAAGAGAGAAGAGGAAAGG - Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1071774012 10:88764413-88764435 CTGCATATACACAACTGGCCGGG - Exonic
1071994235 10:91131101-91131123 CTGCAAACACACTAGAGGCTGGG + Intergenic
1072086523 10:92084872-92084894 GTTAAAATACAGATGAGGCCGGG - Intronic
1073009726 10:100349704-100349726 CCGCAGAGACAGAACAGGCCAGG + Intronic
1073138347 10:101231757-101231779 ATGCAAAGACTGAAGAGGACAGG - Intergenic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074530121 10:114291281-114291303 CAGCAACTACAGAGAAGGCCTGG + Exonic
1075199185 10:120387973-120387995 CTGCATATTCAGAAGATTCCCGG - Intergenic
1076387623 10:130068448-130068470 CTGAAAATACAAAAGTCGCCAGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1078231074 11:9443429-9443451 CTGCAAATACAAAATTAGCCAGG + Intronic
1079395619 11:20060589-20060611 CTGCTAAGAGAGAAGAGGGCTGG + Intronic
1079882423 11:25944175-25944197 TTGCCAACACAGAAGAGGCAGGG + Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1082952386 11:58831068-58831090 CTGCCAATACGCAAGAGGCAGGG - Intergenic
1083465213 11:62841021-62841043 CTAAAAATACAAAACAGGCCGGG + Intronic
1083786959 11:64956003-64956025 CTAAAAATACAAAAAAGGCCCGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086543499 11:87941265-87941287 CTTCAAATACAGAAATGGCCTGG + Intergenic
1087036201 11:93758678-93758700 CCCCAAATCCAGAAGGGGCCGGG - Intronic
1087429892 11:98040244-98040266 CTGCTAATTCAGAAGCTGCCAGG - Intergenic
1089555433 11:119313560-119313582 CTGAAAATACAAAAGTAGCCGGG - Intronic
1089559606 11:119337216-119337238 GTCCAAATACAGAAGGGCCCAGG + Exonic
1089671883 11:120062426-120062448 CTGCAGTGACAGAGGAGGCCCGG + Intergenic
1089921332 11:122212352-122212374 CTGCATCTACAGAGGACGCCTGG + Intergenic
1089982265 11:122782078-122782100 TTGTAAATACAAAAGAGGCCAGG + Intronic
1091448932 12:560851-560873 CTGCACATGCACAAAAGGCCTGG + Intronic
1092854416 12:12659350-12659372 TTGAAAATAAAAAAGAGGCCAGG + Intergenic
1095050675 12:37551534-37551556 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1096437539 12:51607056-51607078 CTGCAAATACAAAAATAGCCAGG - Intronic
1096807639 12:54150264-54150286 CTGAAAATACAAAATTGGCCAGG - Intergenic
1096967407 12:55639199-55639221 CTGAAAATACAGAATTAGCCGGG - Intergenic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1097915899 12:65019985-65020007 CTGAAAACACACAAAAGGCCAGG - Intergenic
1098953475 12:76665374-76665396 CTTCCAATACAGTAGAGCCCTGG + Intergenic
1100563335 12:95770842-95770864 CAGCAAACATAGCAGAGGCCTGG + Intronic
1101162879 12:101997061-101997083 CTGAAAATACAAAATAAGCCGGG - Intronic
1101230255 12:102733580-102733602 CTAAAAATACAAAAGAAGCCAGG + Intergenic
1101489244 12:105196600-105196622 CTGGAAATACAAAATTGGCCGGG - Intronic
1102801104 12:115734662-115734684 CTGCAAAACCACAAGAGGCCAGG + Intergenic
1102950534 12:117027952-117027974 CTGCACAGACAGAAGCGGCTGGG + Intronic
1103403561 12:120659425-120659447 CTGCAAATAAAACAGAGTCCAGG - Intronic
1104041666 12:125134771-125134793 CTGGAAAGAGAGAAGAGGTCAGG - Intronic
1105368916 13:19785830-19785852 CTAAAAATACAAAAAAGGCCGGG + Intergenic
1106157089 13:27169567-27169589 TGGCAAATACAGAAAATGCCTGG - Intronic
1106716789 13:32398305-32398327 CTGCAAAAAGAGAAGAGCCTTGG + Exonic
1106780980 13:33058633-33058655 TTGAAAATACAGGACAGGCCGGG - Intronic
1108001309 13:45907810-45907832 CTGCAGAGACAGCAGAGGTCTGG + Intergenic
1108148785 13:47508763-47508785 CTGCCAAGTCAGAAGAGGCATGG + Intergenic
1108887672 13:55208169-55208191 CTGCAATTATAGAAGAAGACTGG + Intergenic
1110342815 13:74413396-74413418 CTGCCAATTCAGAAGGGGGCAGG - Intergenic
1110816337 13:79864459-79864481 TGACACATACAGAAGAGGCCTGG - Intergenic
1113326121 13:109282973-109282995 CTGCACACCCAGGAGAGGCCAGG - Intergenic
1113494728 13:110717664-110717686 CTGAAAATACAGAATTAGCCGGG + Intronic
1114448645 14:22809634-22809656 CTAAAAATACAAAAAAGGCCGGG - Intronic
1114734049 14:25024771-25024793 CTGCTAATTCAGTAGAGGGCAGG + Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115204071 14:30882423-30882445 CTTAAAATACTGAAGGGGCCAGG - Intronic
1115226484 14:31108249-31108271 CTGAAAATACAGAATTAGCCAGG - Intronic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1116935977 14:50740641-50740663 CTACAAATACAAAAATGGCCAGG - Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1117512535 14:56468162-56468184 CTGCAAACAAAGAAAAGCCCAGG + Intergenic
1118191554 14:63585237-63585259 CTAAACATACAGAAGGGGCCGGG - Intergenic
1118458507 14:65966698-65966720 CTGATAACACAGAAGAGCCCTGG + Intronic
1119204652 14:72784988-72785010 ATGAAAATAAAGAAAAGGCCAGG + Intronic
1120263439 14:82218287-82218309 CTGCAAATAAAGACAAGTCCAGG - Intergenic
1120568561 14:86089963-86089985 CTACAAACCCAGAAAAGGCCTGG - Intergenic
1120841994 14:89094305-89094327 CAGCAGAAACAGAAGAGTCCTGG - Intergenic
1122051815 14:99066009-99066031 CTGGAAAGCCAGAAAAGGCCAGG + Intergenic
1122543006 14:102508294-102508316 CCCCAAATAAAGAAAAGGCCAGG + Intronic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1123517835 15:21046052-21046074 CTGAAAATACAGAATTAGCCGGG + Intergenic
1123911950 15:24976972-24976994 CTGCCAATCCAGCAGGGGCCTGG - Exonic
1124094503 15:26636530-26636552 GTGCAGATAGAGAAGAGACCAGG - Intronic
1125174084 15:36800286-36800308 CTGCAAATACAGACCTGGCAAGG + Intronic
1126578145 15:50217758-50217780 CTCAAAAAACAGAAGAGGCCAGG + Intronic
1126711623 15:51463471-51463493 CTGGAAATGCAGAAGAATCCCGG + Exonic
1127426397 15:58863210-58863232 CTGAAAATACAGAATTAGCCAGG - Intergenic
1128045543 15:64614526-64614548 CTTGAAATACAGAAAAGGCCAGG - Intronic
1128056988 15:64707178-64707200 CTTAAAAAACAAAAGAGGCCGGG + Intergenic
1128173231 15:65530973-65530995 CTGCGAACAAAGAAGAGGCCCGG - Intronic
1128555767 15:68630753-68630775 CCACAAGGACAGAAGAGGCCTGG - Intronic
1128579475 15:68798760-68798782 CTGCAAGTGGAGAAGAGGCAGGG + Intronic
1129546122 15:76397450-76397472 CTGCCAATAAAGAAAAGCCCAGG - Intronic
1133476883 16:6132243-6132265 CTGGAAATAGAGAAGAGCCAAGG - Intronic
1133624921 16:7562360-7562382 CTGAAGTTACAGAAGAGGGCAGG + Intronic
1134337082 16:13310181-13310203 TTTAAAATACAGAACAGGCCGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134681161 16:16126678-16126700 ATACAAATACATAACAGGCCAGG - Intronic
1135034622 16:19066917-19066939 CTGAAAATAGAGAAAAGACCGGG + Intergenic
1135148571 16:19985258-19985280 CTCCAAATACAGAAGCTGACAGG - Intergenic
1135935150 16:26773690-26773712 ATGCCAAGACAGAAGAGGCAAGG + Intergenic
1138462506 16:57159351-57159373 CTGCAAATGCAGAAGTTGGCAGG - Intronic
1138995686 16:62449939-62449961 CATCAAAGAGAGAAGAGGCCAGG - Intergenic
1140640748 16:76969419-76969441 CTTAAAAAACAAAAGAGGCCTGG - Intergenic
1140657351 16:77154515-77154537 CTACAAATATAGAAGATGACAGG - Intergenic
1140692689 16:77499463-77499485 CAGCCAACACAGCAGAGGCCAGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141672109 16:85497601-85497623 CTGCACAGACATAGGAGGCCTGG - Intergenic
1142463035 17:108752-108774 CTGAAAATACAGAATTAGCCAGG - Intergenic
1143159564 17:4860283-4860305 CTAGAAATGCAGGAGAGGCCTGG - Intronic
1143620652 17:8078472-8078494 TTGAAAATACACAAGAGGGCCGG + Intronic
1143892212 17:10111237-10111259 CTAAAAATACAGAAATGGCCAGG + Intronic
1144042118 17:11421299-11421321 CTGCAGATTCAGCAGAGGCATGG + Intronic
1144891930 17:18499300-18499322 CTGCAAACATAGAGGTGGCCCGG + Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145140292 17:20445017-20445039 CTGCAAACATAGAGGTGGCCCGG - Intergenic
1145203569 17:20968504-20968526 CAGCAAACACAGAAAACGCCAGG - Intergenic
1146030982 17:29365719-29365741 AGGCAAATACTGAAAAGGCCAGG - Intergenic
1146643884 17:34563549-34563571 ATGGAAATACACAAGAGGCAAGG - Intergenic
1146713663 17:35065237-35065259 TCGCAAATACAGAACAGGTCAGG - Intronic
1149088614 17:52751184-52751206 CTGCCAACTCAGAAGGGGCCGGG - Intergenic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150740885 17:67778318-67778340 CTAAAAATACAAAAGTGGCCGGG + Intergenic
1151460838 17:74253180-74253202 CTGCAGCTACAGCAGTGGCCTGG + Exonic
1151677896 17:75609025-75609047 CTAAAAATACAAAAAAGGCCAGG - Intergenic
1151718147 17:75842040-75842062 CTAAAAATACAAAAAAGGCCGGG - Intronic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1155281332 18:24243066-24243088 CTGAAAATACAAAATAAGCCAGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155606186 18:27608662-27608684 CTGAAAATACAGAATTAGCCCGG + Intergenic
1155961350 18:31998003-31998025 CTGAAAATACAGAATTAGCCAGG - Intergenic
1156442750 18:37207968-37207990 CTGCAAATACAGAATTAGCCAGG - Intronic
1157256080 18:46140907-46140929 CTGCAAATAAAGAGTTGGCCAGG + Intergenic
1157828137 18:50831145-50831167 ATGAAAATAGACAAGAGGCCGGG - Intergenic
1158412926 18:57223546-57223568 CTACCAAGACAGCAGAGGCCTGG - Intergenic
1159870099 18:73751523-73751545 CTTCCAATACAGCAGAGGCGAGG - Intergenic
1160006347 18:75071885-75071907 CTCCAAATGCATTAGAGGCCAGG - Intergenic
1160117026 18:76089009-76089031 TAGCAAATGCAGAATAGGCCAGG + Intergenic
1161132333 19:2598360-2598382 CTGAAAATACAGAATTGGCCGGG + Intronic
1161182451 19:2893425-2893447 CTGAAAATACAGAATTGGCCGGG + Intergenic
1161215262 19:3091896-3091918 CTGAAAATACAGAATTAGCCAGG - Intergenic
1161681566 19:5682258-5682280 CTGCATTGACAGAAGAGGCAGGG + Intronic
1162164571 19:8743546-8743568 GACCAAATACAGAAGAAGCCAGG + Intergenic
1162165643 19:8751014-8751036 GACCAAATACAGAAGAAGCCAGG + Intergenic
1162166708 19:8758470-8758492 GACCAAATACAGAAGAAGCCAGG + Intergenic
1162167774 19:8765926-8765948 GACCAAATACAGAAGAAGCCAGG + Intergenic
1162168713 19:8772224-8772246 GACCAAATACAGAAGAAGCCAGG + Intergenic
1162170459 19:8784988-8785010 GACCAAATACAGAAGAAGCCAGG + Intergenic
1163360888 19:16845622-16845644 CTACACAGACAGAAGAGGCTAGG - Intronic
1163659982 19:18571147-18571169 CTAAAAATACAAAAGTGGCCAGG + Intergenic
1163735885 19:18980414-18980436 CTAAAAATACAGAAATGGCCAGG - Intergenic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1165233591 19:34403255-34403277 CTAAAAATACAAAAAAGGCCGGG + Intronic
1165244164 19:34488367-34488389 CTCCAAAAAAAGAAGAGGCCAGG - Intronic
1165251904 19:34545422-34545444 CTTCAGTGACAGAAGAGGCCTGG - Intergenic
1165268524 19:34682719-34682741 CTTCAGTGACAGAAGAGGCCTGG + Intronic
1165274774 19:34739090-34739112 CTTCAGTGACAGAAGAGGCCTGG + Intronic
1165566556 19:36734328-36734350 CTAAAAAAACAGAAAAGGCCAGG + Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1165903109 19:39177946-39177968 CTGCACAGACACATGAGGCCCGG - Intronic
1168546964 19:57260779-57260801 GTGCAAATACAGAAAAGGTGTGG - Intergenic
1202665793 1_KI270708v1_random:118049-118071 CTGCAAATACAAAATTAGCCAGG + Intergenic
925526553 2:4809207-4809229 CTGCAAATACAAAATTAGCCAGG + Intergenic
928455965 2:31422348-31422370 CTGCAAATACACAAAGGCCCAGG + Intergenic
928548932 2:32353182-32353204 CTGAAAATACAAAATAGGCCGGG - Intergenic
929205231 2:39284320-39284342 CTACAAATACAGAAACAGCCGGG - Intronic
929397294 2:41537394-41537416 CTTGAAAAACAGAATAGGCCAGG - Intergenic
929992347 2:46800938-46800960 CTGCAAAGACAGAGAAGGCCAGG + Intergenic
931654424 2:64498054-64498076 CTGAAAAAAAAGAAAAGGCCGGG - Intergenic
931689274 2:64821575-64821597 CTGAAAATACAAAAGTAGCCGGG - Intergenic
935017286 2:99195919-99195941 CTGAAAATACAGAATTAGCCAGG + Exonic
936602172 2:113907809-113907831 CTGAAAATACAAAATTGGCCAGG + Intronic
936656476 2:114493882-114493904 CTAAAAATTCAGTAGAGGCCAGG - Intronic
936760109 2:115767787-115767809 CTGAAAATACAAAAGACGACAGG - Intronic
936920904 2:117687463-117687485 CTGGAAATACTGATGAGGGCAGG + Intergenic
937081785 2:119145437-119145459 CTACAAATACATGAGGGGCCTGG - Intergenic
940077578 2:149760298-149760320 CTAAAAATACAGAATTGGCCGGG - Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940975528 2:159939210-159939232 TTAAAAATACAGATGAGGCCAGG + Exonic
941512557 2:166431395-166431417 CTGCCAAAACAGAAGAGGTCTGG + Intronic
941779191 2:169426526-169426548 CAGCAAATGCAGAATTGGCCAGG + Intergenic
942187535 2:173438503-173438525 CTGCTAATCCACAAAAGGCCGGG + Intergenic
944132624 2:196363131-196363153 TTGCATGTCCAGAAGAGGCCTGG - Intronic
945264218 2:207874411-207874433 CTGAAAATACAAAAGTAGCCAGG + Intronic
945724672 2:213462095-213462117 CAGCAAATAAATAAGAGGCAAGG + Intronic
947599979 2:231441146-231441168 CTAAAAATACAAAATAGGCCGGG - Intergenic
1169163148 20:3399776-3399798 ACACAAACACAGAAGAGGCCTGG + Intronic
1169215671 20:3793294-3793316 CTGAAAATACAAAATTGGCCAGG + Intronic
1169253616 20:4080667-4080689 CTGTATCTAAAGAAGAGGCCTGG + Intergenic
1170188363 20:13618018-13618040 CTGCAGCTGCACAAGAGGCCTGG + Intronic
1171480850 20:25454685-25454707 GTGCACACACAGAAGAGGCCCGG - Intronic
1171545185 20:25995002-25995024 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1171946927 20:31387100-31387122 CTGAAAATACACAATAGGCTGGG - Intronic
1173475736 20:43358064-43358086 CTGCCAATACTGAAGCAGCCAGG + Intergenic
1173838490 20:46140792-46140814 CTGGCAATGCAGCAGAGGCCTGG - Intergenic
1177452182 21:21284308-21284330 ATGCAAATATAGAAGATGCAGGG + Exonic
1178346798 21:31835746-31835768 CAGGAAAGACAGAAGAGCCCAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1180123993 21:45775138-45775160 CTCCCAATACAGAAAAGTCCAGG - Intronic
1180245622 21:46545589-46545611 ATGCAAATATAGCAGAGGGCTGG - Intronic
1180667645 22:17527160-17527182 ATACAAATGCAGACGAGGCCAGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182660377 22:31920756-31920778 TTTAAAATACAGAACAGGCCGGG + Intergenic
1183054504 22:35295402-35295424 CCACAGATACAGAAGAGGCATGG - Exonic
1183226562 22:36554180-36554202 CAGCATACACAGGAGAGGCCAGG - Intergenic
1184170627 22:42757494-42757516 CTGTGAGTGCAGAAGAGGCCAGG - Intergenic
1184563843 22:45279310-45279332 CTCCAAACACTGAAGAGCCCGGG - Intergenic
949469316 3:4377859-4377881 CTCCAAAAACGCAAGAGGCCGGG + Intronic
949942285 3:9164156-9164178 CTGAAAATACAGAATTAGCCAGG - Intronic
953521421 3:43646803-43646825 ATGTAAAGAAAGAAGAGGCCAGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
957831429 3:85526085-85526107 CAGGAAATCCAGGAGAGGCCTGG - Intronic
958547548 3:95573540-95573562 CTTGGAATACAGGAGAGGCCAGG - Intergenic
959936636 3:112036405-112036427 CTACAAATACAGAATTAGCCAGG + Intronic
960245829 3:115399523-115399545 CTTAATATACAGCAGAGGCCAGG - Intergenic
960756103 3:121014735-121014757 CTGCAAATACAGATAAGTACTGG - Intronic
960780051 3:121310611-121310633 CCTCAAAAACAAAAGAGGCCAGG + Intronic
960892373 3:122463054-122463076 CTAAAAATACAAAAAAGGCCGGG + Intronic
961109731 3:124273844-124273866 CTGCGAATACAGTGGAGGACAGG - Intronic
961593438 3:127997933-127997955 CTGCAAATATCTAAGTGGCCAGG - Intergenic
963217260 3:142762329-142762351 AAAAAAATACAGAAGAGGCCAGG - Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964237305 3:154546460-154546482 CTGGAAATAAACAAGAGGACAGG + Intergenic
964640698 3:158907065-158907087 CTTCAAACACAGATGAGGACTGG + Intergenic
964644542 3:158944430-158944452 CAGCAATTACAGAAGAGGGTGGG - Intergenic
964764779 3:160169393-160169415 CTGCATTTAGAGAAGAGGCTGGG - Intergenic
965036060 3:163439506-163439528 GTGCAAAAACAGTACAGGCCAGG + Intergenic
966025393 3:175274054-175274076 CTGCTAATAAAGAATAGGCTGGG + Intronic
966791663 3:183676638-183676660 ATGCAAAGTCAGAAGAGGCGTGG - Intronic
968012656 3:195295272-195295294 CTGTAAATAGCGACGAGGCCAGG - Intronic
968087256 3:195879373-195879395 CTGCAAGTGAATAAGAGGCCTGG - Intronic
968326611 3:197823261-197823283 CTAAAAATACAAAAAAGGCCGGG - Intronic
969917263 4:10502811-10502833 AAGCAAAGACAGAAAAGGCCCGG + Intronic
970141912 4:12992373-12992395 CTGCATATACAGCAGTGGTCTGG + Intergenic
970393310 4:15639001-15639023 CTAAAAATACAGAAGTAGCCGGG + Intronic
971288677 4:25314556-25314578 CTGCAAATCAGGAAGAGGACAGG - Intronic
971838190 4:31796891-31796913 CTCTAAATAAAGAAAAGGCCAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
979246206 4:118507660-118507682 CTGCAAATACAGTACAGCCCAGG + Intergenic
980685807 4:136226354-136226376 TTGCAAAAAGAGAAGAGGACAGG - Intergenic
981719948 4:147791405-147791427 CCTAAAGTACAGAAGAGGCCGGG - Intronic
981779539 4:148411277-148411299 TTTCGAATACAGAAGAGGACAGG + Intronic
982754152 4:159198739-159198761 GGGTAAAAACAGAAGAGGCCAGG - Intronic
983572664 4:169226869-169226891 TTAAAAATACATAAGAGGCCAGG + Intronic
985478635 5:93556-93578 GTGCAAATGCAGATGTGGCCTGG + Intergenic
985566119 5:618586-618608 CTCCAAGTACAGCAGGGGCCGGG + Intronic
985699947 5:1364925-1364947 CTAAAAATACAAAAGTGGCCAGG + Intergenic
985865204 5:2509164-2509186 CTGCACTGACACAAGAGGCCCGG + Intergenic
988262404 5:28905469-28905491 CTGAAAATACAGAAAATGCACGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990343833 5:54851746-54851768 CACCAGTTACAGAAGAGGCCCGG + Intergenic
992220170 5:74563973-74563995 CTTCAACTACAGATGAGGACAGG + Intergenic
992761548 5:79955179-79955201 GTGTAAATAGAGAAGAGGCAGGG - Intergenic
993342784 5:86745252-86745274 CTGGAAAGATAGAATAGGCCGGG - Intergenic
993868305 5:93220628-93220650 ATGCACACAAAGAAGAGGCCAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996913811 5:128686881-128686903 CTGAAAATACAGAATAGAGCAGG - Intronic
996925555 5:128822290-128822312 CTGCTAATACAGAAGACACGAGG - Intronic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
998090305 5:139362703-139362725 CTAAAAATACAAAAAAGGCCAGG - Intronic
999374210 5:151075687-151075709 CTGCAGAGACAGAAGTGGGCTGG + Intronic
1000640394 5:163695690-163695712 CTTCAAATACAGAGAAAGCCAGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004493010 6:16135071-16135093 CTGCTGGTACAGAAGAGGGCTGG - Intronic
1006261892 6:32881330-32881352 CTGAAAATACAAAAGTAGCCAGG + Intergenic
1008939411 6:57030206-57030228 CTGAAAATACAAAATTGGCCGGG + Intergenic
1010553286 6:77249518-77249540 CTGGAATTACTGAAAAGGCCAGG + Intergenic
1011072268 6:83398806-83398828 CTAAAAATACAAAAGTGGCCGGG + Intronic
1014409300 6:121094460-121094482 ATAAAAATACAGAAGTGGCCAGG - Intronic
1014906064 6:127029429-127029451 CTCCAAATTCAGAACATGCCAGG - Intergenic
1014983999 6:127980013-127980035 CTAAAAATACAAAAAAGGCCCGG + Intronic
1016418926 6:143863928-143863950 CTGTAAATAGAAAAGTGGCCTGG + Intergenic
1016805699 6:148210235-148210257 CTGCAAAAACAGACCAGGCATGG + Intergenic
1017522708 6:155216103-155216125 CTTCAAAAATAGAAGAGGACTGG - Intronic
1017549923 6:155495269-155495291 CTGCAAATTAAGAAGAATCCTGG + Intergenic
1017970395 6:159307338-159307360 CTGGGATTACAGGAGAGGCCAGG + Intergenic
1020087108 7:5316438-5316460 CTGAAAATACAGAATTAGCCAGG - Intronic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1021727118 7:23558775-23558797 CTGCCAATAAAGAAAAGCCCAGG - Intergenic
1022021949 7:26408513-26408535 TAGCATATAGAGAAGAGGCCGGG + Intergenic
1022499319 7:30872681-30872703 GTGCAAACATAGAAGAGGCCAGG - Intronic
1022581629 7:31560919-31560941 ATGCAGACAAAGAAGAGGCCAGG + Intronic
1022835697 7:34111872-34111894 CTAAAAATACAGAAGTAGCCAGG - Intronic
1023055056 7:36284436-36284458 CCCCAAAGACAGAAGAGCCCAGG + Intronic
1023853869 7:44168604-44168626 CTGAAAATACAGAATTAGCCAGG - Intronic
1023881092 7:44321932-44321954 CTGCAAAGACAGAAGACTCGAGG + Intronic
1023981384 7:45072640-45072662 CTGTAAATACAGCAGTGGGCTGG + Intronic
1024857146 7:53795001-53795023 CTGCCAACTCAGAAGAGGGCAGG + Intergenic
1025296597 7:57780074-57780096 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1025963829 7:66249047-66249069 GTGCACTTACAAAAGAGGCCAGG - Intronic
1026022863 7:66723739-66723761 CTAAAAATACAAAAGTGGCCAGG - Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026404213 7:70048255-70048277 ATGGAGATACAGAAGAGCCCGGG - Intronic
1029155713 7:98516430-98516452 CTGAAAATACAAAATTGGCCGGG - Intergenic
1029266904 7:99349541-99349563 CTAAAAATACAAAAGAGGCCGGG + Intronic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1030900259 7:115114776-115114798 CTCCAAATTCCCAAGAGGCCAGG - Intergenic
1031767117 7:125794630-125794652 GTGTTAACACAGAAGAGGCCAGG + Intergenic
1032958848 7:137006248-137006270 CTGCCAAAAAGGAAGAGGCCTGG - Intronic
1033247480 7:139729997-139730019 CAGCAGATACTGAGGAGGCCAGG + Intronic
1036274627 8:7339643-7339665 CAGCAAATACAGAAAAGGAAGGG - Intergenic
1036346725 8:7970703-7970725 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036379169 8:8225971-8225993 CTAAAAATACAAAAGTGGCCCGG + Intergenic
1036552689 8:9828958-9828980 GAGCAGATACAAAAGAGGCCAGG + Intergenic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1036842051 8:12131457-12131479 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036850390 8:12196640-12196662 CTAAAAATACAAAAGTGGCCAGG - Intergenic
1036863883 8:12377707-12377729 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036871755 8:12438913-12438935 CTAAAAATACAAAAGTGGCCCGG - Intergenic
1037087079 8:14865639-14865661 CTTCAATTACATAAGGGGCCAGG + Intronic
1037411364 8:18601830-18601852 CTGCGCACACAGAAGAGACCAGG + Intronic
1038627204 8:29205785-29205807 CTTCAAATTAAAAAGAGGCCAGG + Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039297165 8:36169194-36169216 CTGAAAATACAAAATTGGCCAGG - Intergenic
1039734625 8:40318078-40318100 CTGCAACTTCATAAGAGACCTGG - Intergenic
1039812229 8:41059343-41059365 CTGAAAATACAGAATTAGCCAGG + Intergenic
1040753659 8:50743013-50743035 CTGTCAACAGAGAAGAGGCCTGG + Intronic
1040970792 8:53135628-53135650 CTAAAAATACAAAAGTGGCCAGG + Intergenic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041717938 8:60949055-60949077 CTGCTAATTCAGAAGCTGCCTGG - Intergenic
1041718331 8:60952073-60952095 CTGCTAATTCAGAAGCTGCCTGG - Intergenic
1043043587 8:75293387-75293409 ATGAAAATACAGAAGTGGCCGGG + Intergenic
1043608344 8:82030231-82030253 CTTAAAAAACAGAATAGGCCAGG - Intergenic
1043612805 8:82086657-82086679 CTGCAAAAACAGTAGAAGTCTGG + Intergenic
1043684170 8:83066864-83066886 GTGCAAAGACTGAAGGGGCCTGG + Intergenic
1044591752 8:93919364-93919386 CTGAAAATACAGAATTAGCCGGG + Intronic
1044863897 8:96550674-96550696 CTGCCTATACAGCAGAGGTCAGG - Intronic
1045578630 8:103453680-103453702 CTGCAGACAGAGAAGAGGGCTGG - Intergenic
1046711324 8:117514971-117514993 CTGCAATTACACAAGAGCCAGGG + Intergenic
1048693315 8:136993203-136993225 CTCCCAATAAAGAAGAGTCCAGG - Intergenic
1048935600 8:139353277-139353299 CTGAAATTACAGAAGAGGAGAGG + Intergenic
1049120058 8:140728411-140728433 CTGAAAATCCAGAAGGGACCTGG - Intronic
1049516642 8:143062370-143062392 AAGAAAATACACAAGAGGCCGGG + Intergenic
1050002116 9:1088244-1088266 AATCAAATAGAGAAGAGGCCAGG - Intergenic
1050470608 9:5985622-5985644 CTGAAAATACAGAATTAGCCGGG + Intronic
1050599594 9:7236915-7236937 ATGCAAATTCAGAAGATTCCAGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1052794492 9:32910808-32910830 CTAAAAATACAAAACAGGCCAGG + Intergenic
1055286566 9:74734915-74734937 GTGAAAATAGAGAATAGGCCAGG + Intronic
1055517531 9:77048333-77048355 CTACAAATACAGAATTAGCCAGG - Intergenic
1057602249 9:96468552-96468574 CTAAAAATACAAAAAAGGCCGGG - Intronic
1057643704 9:96853562-96853584 CTGACAATGCAGAAGGGGCCAGG + Intronic
1059284845 9:113163355-113163377 CCTCAAAGACAGAAGAGGTCAGG - Exonic
1060739303 9:126087836-126087858 ATGCAAAGACCAAAGAGGCCTGG + Intergenic
1061474661 9:130856381-130856403 CTGGAAATACAAAAACGGCCAGG - Intronic
1062000372 9:134212875-134212897 CTGCAACTCCAGGAGTGGCCTGG + Intergenic
1062387670 9:136319541-136319563 CTGAAAATACAAAATAAGCCGGG - Intergenic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1062657299 9:137610856-137610878 CTAAAAATACAAAAAAGGCCGGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188340198 X:28990696-28990718 CTGCAAATATATATGAGACCAGG + Intronic
1190161344 X:48033624-48033646 CTGTATATATTGAAGAGGCCAGG - Intronic
1190517505 X:51239648-51239670 CTGCCAATATAGAAAAGTCCAGG + Intergenic
1191737151 X:64398784-64398806 GTGTAAATAAAGAAGAGGACCGG - Intergenic
1192346391 X:70311460-70311482 AAGCATATACAGAAGAGGTCAGG + Intronic
1192776069 X:74246227-74246249 CTTCAAATACACACGAGTCCAGG - Intergenic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1196810591 X:119626082-119626104 CTGGAAGTACAGAAGAAGACAGG + Intronic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic