ID: 1163747846

View in Genome Browser
Species Human (GRCh38)
Location 19:19058622-19058644
Sequence ATCTATAAGATAGACATCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163747841_1163747846 -10 Left 1163747841 19:19058609-19058631 CCTCGATTTCCCCATCTATAAGA 0: 1
1: 3
2: 38
3: 537
4: 2848
Right 1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163747838_1163747846 10 Left 1163747838 19:19058589-19058611 CCCAACCTCTTGTCTCTGAGCCT 0: 1
1: 0
2: 15
3: 334
4: 965
Right 1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163747839_1163747846 9 Left 1163747839 19:19058590-19058612 CCAACCTCTTGTCTCTGAGCCTC 0: 1
1: 0
2: 24
3: 468
4: 937
Right 1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163747837_1163747846 18 Left 1163747837 19:19058581-19058603 CCTAGGTACCCAACCTCTTGTCT 0: 1
1: 0
2: 0
3: 21
4: 159
Right 1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163747840_1163747846 5 Left 1163747840 19:19058594-19058616 CCTCTTGTCTCTGAGCCTCGATT 0: 1
1: 0
2: 3
3: 42
4: 363
Right 1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163747846 Original CRISPR ATCTATAAGATAGACATCGG CGG Intronic
910939072 1:92513848-92513870 ATCTATAAAATCTTCATCGGAGG + Exonic
920113953 1:203606692-203606714 ATCTATAAGAAAGACATTGTGGG + Intergenic
920175009 1:204095206-204095228 AACTCTAAGATGGACATCCGAGG + Intronic
921027338 1:211298661-211298683 ATCTTTGTGATAGACATCAGTGG + Intronic
1069675694 10:70245643-70245665 ATCTATGAGAGATACATAGGAGG + Intergenic
1081575011 11:44313681-44313703 ATCTATAAGATAAAATGCGGAGG - Intergenic
1085983797 11:81759226-81759248 ATCTATAGGATAGATATGGATGG - Intergenic
1086515174 11:87603780-87603802 ATCTAGAAGATGGACACAGGTGG + Intergenic
1101805080 12:108056576-108056598 ATCTATATGATAGATTTCAGGGG - Intergenic
1102211544 12:111130969-111130991 ATTCATAAGATAGAAATCTGGGG - Intronic
1108273447 13:48785002-48785024 ATAGATGAGATAGACGTCGGGGG - Intergenic
1109985153 13:69971168-69971190 CTCTATAATATAGAAAACGGAGG - Intronic
1113765685 13:112879858-112879880 ATATATAACATATACATCTGAGG - Intronic
1115623076 14:35160130-35160152 TTGTATAAGTTAGACAGCGGAGG + Intronic
1119501628 14:75133086-75133108 ATGTATAAAATAGACATCGAGGG - Exonic
1131671462 15:94624217-94624239 AAGTAGAAGACAGACATCGGTGG + Intergenic
1139315930 16:66068746-66068768 ATCTAAAAGCTATACATCTGGGG - Intergenic
1140036332 16:71374117-71374139 ATATTTAAGATAGACAGCTGTGG + Intronic
1140719209 16:77755642-77755664 TTATATAAGATAGACTGCGGTGG + Intergenic
1146551230 17:33781937-33781959 ATCTATAAGAGAGCCACCGGTGG - Intronic
1155786413 18:29907382-29907404 ATCTATGAGTTACACATCTGTGG - Intergenic
1159973320 18:74679819-74679841 ATCTATAAAACAGACAACTGTGG - Intronic
1160111378 18:76035036-76035058 ATCTATAAGATAGAAAATGAAGG - Intergenic
1163747846 19:19058622-19058644 ATCTATAAGATAGACATCGGCGG + Intronic
1168394342 19:56035522-56035544 ATAAATAAGATAGACATTGTCGG + Intronic
932831740 2:74996810-74996832 ATCTGTAAGAAAGAAATAGGAGG + Intergenic
939238515 2:139528940-139528962 ATCTATAATATACAAATTGGAGG + Intergenic
939554467 2:143657701-143657723 AGCGATATGATAGACATAGGTGG - Intronic
941466723 2:165837192-165837214 ATCTAAAAGAAAGACATCTGTGG + Intergenic
944535641 2:200707098-200707120 ACCTATAGGATAGAAATTGGGGG + Intergenic
1171075948 20:22123429-22123451 AACTATATTATAGACATCAGTGG + Intergenic
1177039168 21:16084993-16085015 ATCTTTCAGAAAGACATAGGAGG - Intergenic
952056819 3:29457199-29457221 ATCTAGAAGATAGACATGTTAGG - Intronic
954277068 3:49549255-49549277 ATCTATGAAACAGACATGGGTGG + Intergenic
956902192 3:73728553-73728575 AAATATAAGATAAACATTGGAGG - Intergenic
967095862 3:186176686-186176708 ATCTATAAAATATTCCTCGGGGG + Intronic
971744034 4:30556119-30556141 ATCTATAAGTAAGACAACTGAGG - Intergenic
974934448 4:68396347-68396369 ATCAATAAAATAGACATTGATGG + Intergenic
974965126 4:68750959-68750981 ATTTATAAGGTAGAAATAGGAGG + Intergenic
981775002 4:148356423-148356445 ATCTGTGAAATAGACATCTGGGG + Intronic
983031946 4:162813901-162813923 CTTTATAAGATAGACTTCAGGGG - Intergenic
985974289 5:3403327-3403349 GTCTATAACACAGACATAGGTGG - Intergenic
987138292 5:14920057-14920079 TTCTATAAGATAGAGATGAGCGG + Intergenic
989358633 5:40573845-40573867 ATCTGTAACATGGACATCTGAGG + Intergenic
989413447 5:41146228-41146250 ATCTATAAAATAGGCTTCTGGGG + Intronic
996972789 5:129393227-129393249 GTGTATAAGCTAGACATCAGTGG - Intergenic
999616298 5:153428245-153428267 ATCAATTAGAAAGACATGGGGGG - Intergenic
1001370192 5:171192208-171192230 ATCTGAAAAATAGACATGGGGGG + Intronic
1002802325 6:536326-536348 TTCTATATAATAGACATCGAAGG + Intronic
1004476576 6:15979129-15979151 ATATATAAAATAGACAAAGGAGG + Intergenic
1006736685 6:36278623-36278645 ATGTATAAGATGGACAACAGCGG - Intronic
1014881157 6:126726189-126726211 ATCTATAAGAAAGACATTTTAGG + Intergenic
1020586559 7:10077627-10077649 ATGTAAAAGATAGATTTCGGGGG - Intergenic
1025799295 7:64769608-64769630 AGCAATAAAATAGACATTGGCGG - Intergenic
1028122877 7:87076869-87076891 ATCTATGGGATAGACACAGGGGG - Intergenic
1028292395 7:89081654-89081676 ATCTCTAACATAGACATCTTTGG + Intronic
1029745824 7:102515411-102515433 CTTTATAAGATAGACATCCTCGG - Intronic
1029763762 7:102614390-102614412 CTTTATAAGATAGACATCCTCGG - Intronic
1038762162 8:30394416-30394438 ACCTATAGGATAGACAGTGGAGG + Intronic
1039347344 8:36722049-36722071 ATCTCTAAGATGGAAATCAGAGG - Intergenic
1044377133 8:91488794-91488816 ATCTATAAGATAAATATCATTGG - Intergenic
1045714865 8:105030053-105030075 ATTTATAAAATAAACATTGGTGG + Intronic
1048091230 8:131242520-131242542 ATCTCTAAGAACGACATCAGAGG - Intergenic
1049505850 8:142997458-142997480 TGCTAGAAGATAGACATCTGTGG + Intergenic
1056397740 9:86196900-86196922 ATCTAAAAGACAGACTTCGCTGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059957301 9:119531480-119531502 ATATATAAGATGGACAGAGGTGG + Intergenic
1188525488 X:31083529-31083551 ATCTATAAGTTAGCCACTGGTGG - Intergenic
1189014744 X:37085663-37085685 ACCTATAGGATAGACAGTGGAGG + Intergenic
1191971559 X:66822664-66822686 AGCGATAACACAGACATCGGTGG - Intergenic