ID: 1163748672

View in Genome Browser
Species Human (GRCh38)
Location 19:19062845-19062867
Sequence GTTTCATTTGGAAAAGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163748672_1163748681 8 Left 1163748672 19:19062845-19062867 CCCCCCTCTTTTCCAAATGAAAC No data
Right 1163748681 19:19062876-19062898 CTCACAAGGGCTTTTGCCCAAGG No data
1163748672_1163748684 20 Left 1163748672 19:19062845-19062867 CCCCCCTCTTTTCCAAATGAAAC No data
Right 1163748684 19:19062888-19062910 TTTGCCCAAGGTTGTGTGGTGGG No data
1163748672_1163748680 -5 Left 1163748672 19:19062845-19062867 CCCCCCTCTTTTCCAAATGAAAC No data
Right 1163748680 19:19062863-19062885 GAAACAGCTGAGGCTCACAAGGG No data
1163748672_1163748682 16 Left 1163748672 19:19062845-19062867 CCCCCCTCTTTTCCAAATGAAAC No data
Right 1163748682 19:19062884-19062906 GGCTTTTGCCCAAGGTTGTGTGG No data
1163748672_1163748683 19 Left 1163748672 19:19062845-19062867 CCCCCCTCTTTTCCAAATGAAAC No data
Right 1163748683 19:19062887-19062909 TTTTGCCCAAGGTTGTGTGGTGG No data
1163748672_1163748679 -6 Left 1163748672 19:19062845-19062867 CCCCCCTCTTTTCCAAATGAAAC No data
Right 1163748679 19:19062862-19062884 TGAAACAGCTGAGGCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163748672 Original CRISPR GTTTCATTTGGAAAAGAGGG GGG (reversed) Intergenic
No off target data available for this crispr