ID: 1163750039

View in Genome Browser
Species Human (GRCh38)
Location 19:19071300-19071322
Sequence AGATGTACACACTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163750039_1163750044 6 Left 1163750039 19:19071300-19071322 CCCAGCTCCAAGTGTGTACATCT No data
Right 1163750044 19:19071329-19071351 TGCTTTCTGGGCTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 49
4: 317
1163750039_1163750042 -7 Left 1163750039 19:19071300-19071322 CCCAGCTCCAAGTGTGTACATCT No data
Right 1163750042 19:19071316-19071338 TACATCTTAATTTTGCTTTCTGG 0: 1
1: 0
2: 3
3: 35
4: 369
1163750039_1163750043 -6 Left 1163750039 19:19071300-19071322 CCCAGCTCCAAGTGTGTACATCT No data
Right 1163750043 19:19071317-19071339 ACATCTTAATTTTGCTTTCTGGG 0: 1
1: 0
2: 4
3: 36
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163750039 Original CRISPR AGATGTACACACTTGGAGCT GGG (reversed) Intronic
No off target data available for this crispr