ID: 1163750635

View in Genome Browser
Species Human (GRCh38)
Location 19:19075385-19075407
Sequence CTGCATGAACAGAAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 325}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163750631_1163750635 15 Left 1163750631 19:19075347-19075369 CCCGCCGAGCTTTGTTTTTTGTT 0: 1
1: 1
2: 6
3: 110
4: 1280
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325
1163750629_1163750635 21 Left 1163750629 19:19075341-19075363 CCATACCCCGCCGAGCTTTGTTT 0: 1
1: 0
2: 0
3: 10
4: 223
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325
1163750628_1163750635 22 Left 1163750628 19:19075340-19075362 CCCATACCCCGCCGAGCTTTGTT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325
1163750627_1163750635 25 Left 1163750627 19:19075337-19075359 CCTCCCATACCCCGCCGAGCTTT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325
1163750633_1163750635 11 Left 1163750633 19:19075351-19075373 CCGAGCTTTGTTTTTTGTTTGAT 0: 1
1: 1
2: 27
3: 262
4: 3229
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325
1163750630_1163750635 16 Left 1163750630 19:19075346-19075368 CCCCGCCGAGCTTTGTTTTTTGT 0: 1
1: 0
2: 7
3: 318
4: 5884
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325
1163750632_1163750635 14 Left 1163750632 19:19075348-19075370 CCGCCGAGCTTTGTTTTTTGTTT 0: 1
1: 0
2: 13
3: 141
4: 1902
Right 1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG 0: 1
1: 0
2: 7
3: 30
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163750635 Original CRISPR CTGCATGAACAGAAGCAGCA TGG Intronic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
900982327 1:6053328-6053350 CTGCATGAACAAGAGCAACCAGG + Intronic
904415719 1:30360043-30360065 CTGCATGACCAGAGGCTCCAGGG - Intergenic
904781973 1:32956629-32956651 TTGTATGAACTTAAGCAGCAGGG - Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
906529221 1:46513612-46513634 CTGGATGGAGAGCAGCAGCAGGG + Exonic
906537335 1:46558784-46558806 CTGCAGGAACAGCAGCACAATGG - Exonic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
906895260 1:49763930-49763952 TTGCATGACAAGAAGTAGCAGGG - Intronic
908854285 1:68406976-68406998 CTGCAAGAACAGAAGCCACGAGG - Intergenic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
911704604 1:100996997-100997019 CTCCATTAACAAAAGCAGGAAGG - Intronic
912029339 1:105219728-105219750 CTGCAGTAACCAAAGCAGCATGG - Intergenic
912150943 1:106857975-106857997 CTGCAGTAACAAAAACAGCATGG + Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
914195509 1:145446213-145446235 CTCCCTGGATAGAAGCAGCATGG - Intergenic
915537984 1:156549022-156549044 CAGCTTGAACAGAAGCATAAAGG + Intronic
916583529 1:166129714-166129736 GTGCAGGAGAAGAAGCAGCAGGG - Intronic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917307086 1:173638145-173638167 GTGCATGAACACAAACAGGAAGG + Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918063657 1:181084514-181084536 CAGCATGATCAGAAACAGTAGGG - Intergenic
918354848 1:183697952-183697974 ATGCATGATGAGAAGCAGCTTGG + Intronic
918592479 1:186255528-186255550 CTGCATGAACACTTGCAGTAAGG + Intergenic
919669145 1:200322898-200322920 CTTCATGGTTAGAAGCAGCAGGG - Intergenic
920114578 1:203611150-203611172 CACCATTAAGAGAAGCAGCAGGG - Intergenic
921051229 1:211513271-211513293 CTGCATGGTGAGAAGCAGCATGG - Intergenic
921779869 1:219149997-219150019 CTTCATAAACAGAAACCGCAAGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064947478 10:20806972-20806994 CTGCATCTACAGAACCAGGAAGG + Intronic
1065251701 10:23821977-23821999 TAGCCTGAACACAAGCAGCAGGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066336094 10:34480053-34480075 CTGCAAGGACTGCAGCAGCAGGG - Intronic
1066525584 10:36275520-36275542 CTACAATAACAAAAGCAGCATGG + Intergenic
1066571554 10:36778607-36778629 CTGCAGGGTCAGAAGCAGAATGG - Intergenic
1067174468 10:43933842-43933864 TGGCAAGCACAGAAGCAGCAAGG + Intergenic
1067221203 10:44345616-44345638 CTGCATGAACTGAGACAGCCAGG - Intergenic
1068201315 10:53787566-53787588 CAGCATGAACAAAAGAAGCCTGG - Intergenic
1068861912 10:61855984-61856006 CTGCATGAAGAGCAGCAAGAAGG + Intergenic
1071367895 10:84919144-84919166 CTGCAGTAACTGAAACAGCATGG + Intergenic
1072380842 10:94868346-94868368 CTGCAGTAACAAAAACAGCATGG - Intergenic
1072622607 10:97090051-97090073 CTGGATGAACAGCAGCGGCGAGG - Intronic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1076871687 10:133197836-133197858 CTGCATGGACAGACACAGCCGGG + Intronic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1078181049 11:9010769-9010791 CTGCAGTAACAAAAACAGCATGG - Intergenic
1078316744 11:10299780-10299802 GTGCAAGAAAGGAAGCAGCACGG - Intergenic
1078674353 11:13395919-13395941 CTGCAGTAACAAAAACAGCATGG - Intronic
1079478488 11:20857088-20857110 CTGTATGCACAGCATCAGCAGGG - Intronic
1079995516 11:27291379-27291401 CTGTATGTACAGCAACAGCAGGG + Intergenic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1083768842 11:64855197-64855219 CTCCCTGAACGGAAGCAGCTGGG - Intronic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1084800182 11:71538506-71538528 CAGCCTGAAGAGCAGCAGCAGGG - Exonic
1086662039 11:89430965-89430987 CTGCAGTAACCAAAGCAGCATGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087560769 11:99786615-99786637 CTGCATTAATGGAAACAGCATGG + Intronic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1088683968 11:112269534-112269556 CTGCAACAACAGAACCAACACGG - Intronic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092389708 12:8065221-8065243 CTGCATGAACTGAAGTAGCAGGG + Intronic
1092397232 12:8137996-8138018 CTGCATGATGAGTAGCAGAAAGG + Intronic
1092918165 12:13206860-13206882 CTGCCTGAACAAAGGCAACAAGG + Intronic
1093209134 12:16286473-16286495 CTGCAGTAACAAAAACAGCATGG - Intergenic
1097450952 12:59736138-59736160 CTCCAGGGACAGAAGCATCATGG + Intronic
1098632465 12:72740751-72740773 CTGCTTGATGAGGAGCAGCAGGG - Intergenic
1098872321 12:75830542-75830564 CTACAGTAACAGAAGCAGCATGG + Intergenic
1099025894 12:77464018-77464040 CTGCAGTAACCAAAGCAGCATGG + Intergenic
1099032832 12:77549579-77549601 GTTCATGGACAGATGCAGCAGGG + Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1101525437 12:105524209-105524231 CTTCAAGCAGAGAAGCAGCATGG + Intergenic
1101525590 12:105526018-105526040 CTCCACAAACAGAAGCAGAATGG - Intergenic
1102252384 12:111396376-111396398 CTACATTAAAAGAAGCATCAAGG - Intergenic
1102322367 12:111948217-111948239 CTCCCTCAACAGGAGCAGCAAGG - Intronic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1104107217 12:125674529-125674551 GTGCAGGAACAGAAGCAATAAGG - Intergenic
1106681897 13:32017004-32017026 CTGAGTGAACAAGAGCAGCAAGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1108007701 13:45968429-45968451 CTGCATGAAGAATAGCAGGAAGG + Intronic
1109629155 13:65021225-65021247 CTACATAAACCAAAGCAGCATGG - Intergenic
1109910374 13:68903505-68903527 CTGCAGAAACAAAAACAGCATGG - Intergenic
1111600707 13:90470554-90470576 CTGCAGTAACAAAAACAGCATGG - Intergenic
1112142017 13:96654589-96654611 CTGCAGTAACAAAAACAGCACGG - Intronic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1115041166 14:28930427-28930449 CTGCCTGAACTAAAGCAGAAAGG - Intergenic
1115708858 14:36028022-36028044 CAGCAAGAGTAGAAGCAGCAGGG - Intergenic
1115754331 14:36517973-36517995 CGGCATGAACATGAGCGGCATGG - Exonic
1116742312 14:48772284-48772306 CAGCATGAAGAGAAGAAACAAGG + Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1118123255 14:62869707-62869729 CTGCAGTAACTGAAACAGCATGG + Intronic
1118395766 14:65335138-65335160 CTCCTTGAACAGGAGGAGCAAGG - Intergenic
1118625783 14:67657712-67657734 CTCCCAGAACAGAAGTAGCAAGG + Intronic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1124377058 15:29135041-29135063 CAGCATGACCAGAAGCATCCAGG - Intronic
1125227620 15:37412902-37412924 CTGCAGTAACAAAAACAGCATGG + Intergenic
1125371189 15:38978938-38978960 CTACAGTAACAAAAGCAGCATGG - Intergenic
1125541303 15:40471326-40471348 CAGCATGGACGGCAGCAGCAGGG - Exonic
1125688603 15:41578642-41578664 ATGCATGCACTTAAGCAGCAGGG - Exonic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1127848482 15:62892160-62892182 CTGCTTGACCAGGAGCATCAGGG + Intergenic
1128921314 15:71612566-71612588 CTCCATCAACAGCTGCAGCACGG - Intronic
1129157309 15:73726637-73726659 CTGCATGGAGAGGAGAAGCAAGG + Intergenic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129395751 15:75245090-75245112 CTGGATCATCAGCAGCAGCACGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1132096862 15:98992707-98992729 CTGCAGTAACAAAAACAGCATGG + Intronic
1134235599 16:12463074-12463096 CAGCATGGGCAGCAGCAGCAGGG - Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1134594909 16:15488500-15488522 ACGCATGATGAGAAGCAGCAGGG - Intronic
1135673486 16:24394425-24394447 CTGCATATTCAGCAGCAGCAGGG - Intergenic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1144449391 17:15363669-15363691 AGGCAGGAACAGGAGCAGCAGGG - Intergenic
1144617038 17:16786156-16786178 CTGCAGTAACAGAAATAGCATGG + Intronic
1144895655 17:18529518-18529540 CTGCAGTAACAGAAATAGCATGG - Intergenic
1145136563 17:20414713-20414735 CTGCAGTAACAGAAATAGCATGG + Intergenic
1146464182 17:33073376-33073398 CTGCGAGCTCAGAAGCAGCATGG + Intronic
1149122718 17:53189657-53189679 CTGCTGGGACAGCAGCAGCATGG - Intergenic
1149163036 17:53717808-53717830 CTACAGTAACAAAAGCAGCATGG - Intergenic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1152334330 17:79691794-79691816 GTGCATGAAGACAAGCAGGATGG - Intergenic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1155319880 18:24608806-24608828 CTGTATGTACAGCATCAGCAAGG + Intergenic
1155534668 18:26804864-26804886 CTGAAAGAACTAAAGCAGCAGGG - Intergenic
1155833159 18:30543440-30543462 ATGCCTGAACAGTAGCAGCAAGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158389163 18:57029874-57029896 ATGAATGATTAGAAGCAGCAGGG - Exonic
1158964699 18:62612153-62612175 CTGCAGGAACGGAGGCAGCCAGG - Intergenic
1159844121 18:73438272-73438294 CACCATGAACAGCAGGAGCAGGG - Intergenic
1160909748 19:1469081-1469103 CTGCATGAACGGGATCCGCACGG - Exonic
1161199995 19:3009298-3009320 CTGCATGAAGAGGAGCAGTAGGG - Intronic
1161681566 19:5682258-5682280 CTGCATTGACAGAAGAGGCAGGG + Intronic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1162230612 19:9262836-9262858 CTGCATGTCCAGGAGCAGTATGG - Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1163892998 19:20033362-20033384 CTTCATGGGCAGAAGCACCATGG - Intronic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1165293047 19:34904796-34904818 CTGCCTGAAAGGAAGCAGCTGGG + Intergenic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167018386 19:46856748-46856770 CTGCATGAACGGAACCATCAAGG - Intergenic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167065645 19:47183867-47183889 CTGCCTGGTCACAAGCAGCAGGG - Intronic
1167266125 19:48483589-48483611 CTGCATGAACCAAGGCAGCGGGG - Intergenic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
926414299 2:12633897-12633919 CTGCATGAACAAAGATAGCAAGG + Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
928653592 2:33426637-33426659 ATGCAGTATCAGAAGCAGCAAGG + Intergenic
928674368 2:33635998-33636020 CAACATGAACAGAAGCATAAAGG - Intergenic
929138376 2:38646081-38646103 CAACAGGAACAGAAGAAGCAGGG - Intergenic
929361234 2:41093767-41093789 CTACAGTAACAAAAGCAGCATGG + Intergenic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930611201 2:53545917-53545939 GCACATGAACAGAAGCAGCCAGG + Intronic
931532881 2:63236588-63236610 CTGCAGTAACCGAAACAGCATGG + Intronic
935437477 2:103050857-103050879 CTGTAGGAACAAAAACAGCATGG - Intergenic
936247234 2:110838868-110838890 CTGCATGAACAGGACCTGCAAGG - Intronic
936500168 2:113060575-113060597 CTGCTGGAAGAGAAGCTGCACGG - Intronic
937390541 2:121482191-121482213 CTTCCTGAACAGATGTAGCAGGG + Intronic
939614007 2:144342308-144342330 CTATAGGAACAAAAGCAGCATGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941779389 2:169427527-169427549 GTGCCTGAACAGAAGCATCAGGG + Intergenic
942528671 2:176884560-176884582 TTGCATGAAAAGAAGCAACAAGG - Intergenic
943351137 2:186797729-186797751 CTGCAGTAACCGAAACAGCATGG + Intergenic
943581215 2:189685586-189685608 CTAAATGAAAACAAGCAGCAAGG - Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
945791921 2:214316004-214316026 CTTCATGAACAAAAGAAGCTAGG - Intronic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
947243235 2:228018909-228018931 CTCCATGAACAGGAGAATCATGG - Exonic
948414288 2:237791022-237791044 CTGCTGGAACGGAAGCTGCATGG + Intronic
1170485174 20:16808182-16808204 ATCCAAGAACAGAAGCAGGATGG - Intergenic
1171756001 20:29110297-29110319 CTACAGTAACGGAAGCAGCATGG + Intergenic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1175441015 20:58991325-58991347 CTGCATGAACAGGTCCAGGAAGG - Exonic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1179591961 21:42414899-42414921 CAGCATGAACCCAGGCAGCATGG - Intronic
1179867348 21:44225415-44225437 CTGCATGGACAGCTGCAGCCTGG + Intronic
1180195737 21:46192403-46192425 CTGCTTGAGCAGGAGCAGCAGGG - Intronic
1180413041 22:12634170-12634192 CTACAGTAACCGAAGCAGCATGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181265346 22:21627962-21627984 CAGCATGAACAAAACCAGAATGG + Intergenic
1184197573 22:42940640-42940662 CAGCTTGAAGAGAAGCAGCTGGG - Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184457645 22:44620721-44620743 ATGGATGAACAGGAGCAGAATGG + Intergenic
1184999327 22:48234407-48234429 CTGCATGAACTGAATGATCAAGG - Intergenic
949969709 3:9394824-9394846 CTGCAGGATTAAAAGCAGCAAGG + Intergenic
950561546 3:13731775-13731797 CTACAGGAACAAAAACAGCATGG - Intergenic
951127186 3:18997542-18997564 CGGAAGGAACAGAATCAGCAAGG - Intergenic
952060030 3:29496966-29496988 CTGCATGTACAAAAGCATTAGGG - Intronic
952695710 3:36263386-36263408 CTGCAGGAACCAAAACAGCATGG - Intergenic
953261544 3:41344088-41344110 CTGCAGTAACAAAAACAGCATGG + Intronic
953675510 3:44998566-44998588 CTTCATGAAAAGAAACAGCCTGG + Intronic
954386641 3:50247559-50247581 CTGCGTGAACAAGACCAGCAGGG - Intronic
956292844 3:67679558-67679580 GTCCATGAACAGACACAGCATGG + Intergenic
957147824 3:76446651-76446673 CTGCAGTAACCAAAGCAGCATGG + Intronic
957551515 3:81711578-81711600 CTGCACTAACCAAAGCAGCATGG - Intronic
957992196 3:87640378-87640400 CTGCAATAACCCAAGCAGCATGG - Intergenic
958497844 3:94867251-94867273 CTGCAGTAACCGAAACAGCATGG - Intergenic
958922058 3:100118563-100118585 GTGCTTGAACAGAGGCCGCATGG - Intronic
958991625 3:100852616-100852638 CAGCAGGACCAGAAACAGCAGGG + Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961114430 3:124316558-124316580 CTGCAGAAAGAGGAGCAGCAGGG - Intronic
961253150 3:125523382-125523404 CCCCATGAAGAGAAGCAGCATGG - Intergenic
961315445 3:126032387-126032409 CTGCATGCTGAGAAGCAGCTGGG + Intronic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
962934770 3:140069754-140069776 CCTCATGGAGAGAAGCAGCATGG - Intronic
963587192 3:147207038-147207060 CTGCAGTAACTGAAACAGCATGG - Intergenic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
969498205 4:7538296-7538318 CTGCCTGGCCAGGAGCAGCAAGG - Intronic
969892181 4:10270061-10270083 CAGCATGGCCAGCAGCAGCATGG + Intergenic
970993900 4:22243620-22243642 CTGCAGTAACAAAAACAGCATGG - Intergenic
971737880 4:30480533-30480555 CTACAGTAACAGAAACAGCATGG - Intergenic
974196982 4:58587760-58587782 CTGGTTGAACAGTAGCTGCAAGG + Intergenic
974383135 4:61168668-61168690 CTGCAATAACCAAAGCAGCATGG + Intergenic
975218717 4:71788633-71788655 CTGCTTGAAAAAAAGCAGAAAGG + Intronic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
976029527 4:80734840-80734862 CTACAGTAACAAAAGCAGCATGG - Intronic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
979887467 4:126047001-126047023 ATGCATGAAAAGAAACAGGAAGG + Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
982090367 4:151875259-151875281 CTGCATGAACAGGGGAGGCATGG + Intergenic
982250070 4:153396302-153396324 CAGCACGCTCAGAAGCAGCACGG - Intronic
983329269 4:166303519-166303541 CTGCTTGAAAAGATGCAGAATGG + Intergenic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
987264572 5:16239307-16239329 TTGCAGTAACAGCAGCAGCAAGG - Intergenic
987313424 5:16701835-16701857 CTTCCTGGACAGAAGCAGAAGGG + Exonic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
988821682 5:34892736-34892758 TTGCATGAACAGAAGCATAGTGG + Intronic
989380603 5:40806080-40806102 CTGCATGACCAGTATCATCATGG - Intergenic
989465747 5:41753446-41753468 CAGCATGAACAAAAGCTGAAAGG - Intronic
991409614 5:66333196-66333218 TTGCAGGCACAAAAGCAGCAAGG - Intergenic
991689359 5:69211617-69211639 CTGCATGAAAGGATGCAGAAAGG - Intergenic
993993611 5:94691345-94691367 CTGATAGAACAGAAGCAGTATGG + Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995213293 5:109565567-109565589 CTGCAGTAACAAAAACAGCATGG - Intergenic
996355035 5:122586160-122586182 CTGCTGGAACATAAGCAGCTAGG - Intergenic
997801374 5:136865951-136865973 CTCCATCACCAGAATCAGCATGG - Intergenic
998053023 5:139052263-139052285 CGGCAGGAACAGCAACAGCATGG - Intronic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1001006686 5:168057975-168057997 CTGGATGTACAGCATCAGCAGGG + Intronic
1001630963 5:173175197-173175219 CTGCATTAAGAGAAGCAGGCTGG - Intergenic
1001965083 5:175904331-175904353 CTGCATAATCAAAAACAGCACGG + Intergenic
1002251872 5:177934857-177934879 CTGCATAATCAAAAACAGCACGG - Intergenic
1002662179 5:180798795-180798817 GTGGAAGATCAGAAGCAGCATGG - Intronic
1002689235 5:181038716-181038738 CTGCATAAACAGTAGGATCAGGG - Intergenic
1003774363 6:9343334-9343356 CTGCAAGAGTAGAAGCTGCATGG - Intergenic
1004643706 6:17539614-17539636 CTGCATGGACATAAGGAACATGG - Intronic
1008207800 6:48684727-48684749 CTACATTAACCAAAGCAGCATGG + Intergenic
1008557933 6:52693443-52693465 ATGCATCACCAGTAGCAGCATGG - Intergenic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1010709913 6:79161906-79161928 CTGCACGCAGAGAAGCACCATGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1011129514 6:84038816-84038838 TTGCATGAGCAGAAACATCATGG + Intronic
1014125015 6:117767244-117767266 CTACAGTAACAAAAGCAGCATGG + Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1015488184 6:133795545-133795567 CTACAGTAACAGAAACAGCATGG - Intergenic
1016381520 6:143487663-143487685 CAGCATGAACAGTAGCAGACAGG - Intronic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016598200 6:145825386-145825408 GTGCATGAAGAGAAGAAGAACGG + Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019443370 7:1058611-1058633 CTGCTGGAAGAGAAGCAGGAGGG + Exonic
1021064850 7:16160544-16160566 CTACAGTAACAAAAGCAGCACGG - Intronic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1023211736 7:37813175-37813197 CTACAGTAACTGAAGCAGCATGG + Intronic
1024300373 7:47882883-47882905 CAGCAAGAAGAGAAGCAGCGAGG + Intronic
1024348637 7:48339500-48339522 CTGCATTAACACTAGCACCATGG - Intronic
1024348754 7:48340669-48340691 CTGCATTAACACTAGCACCATGG - Intronic
1024657008 7:51459425-51459447 CTGAATGAACAGACGCAGACTGG - Intergenic
1026324791 7:69299718-69299740 CTGCTGGAACAGAACAAGCAAGG - Intergenic
1026488580 7:70842918-70842940 CTGCAGTAACAAAAACAGCATGG + Intergenic
1027445615 7:78270146-78270168 CTACATTAACACAAACAGCATGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028615235 7:92758513-92758535 CTGCAGTAACCAAAGCAGCACGG - Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1031971850 7:128070322-128070344 GTGCATGTACACAAGCAGCATGG - Intronic
1034197202 7:149257141-149257163 CTGCATGCACAGAATCACCTGGG - Intergenic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1035068612 7:156125068-156125090 CTGCATGGACAGAAACACCACGG + Intergenic
1035863721 8:3058920-3058942 GTGCATTCAGAGAAGCAGCAAGG - Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037187582 8:16082345-16082367 ATGCAGGAGCAAAAGCAGCACGG + Intergenic
1037423062 8:18724791-18724813 AGGCATGAATAAAAGCAGCAAGG + Intronic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1038519917 8:28222258-28222280 CTACAGTAACAAAAGCAGCATGG - Intergenic
1040463577 8:47673553-47673575 CTGCATGAACACATACAGAAAGG + Intronic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041194833 8:55390694-55390716 GTGCATGAAAAACAGCAGCAGGG - Intronic
1044213405 8:89578869-89578891 CAACATGAACAAAAGCATCAAGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044775726 8:95685579-95685601 CTGCCTGTACAGCATCAGCAGGG + Intergenic
1046821610 8:118639746-118639768 CTCCAAGAACAAAAGCAGCATGG - Intergenic
1047905090 8:129464459-129464481 CTGAGGGAACAGAAGCAGCCTGG - Intergenic
1048489751 8:134881668-134881690 ATGCATGAAGAAAAGCAGCCGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1050162730 9:2734807-2734829 CTGGATGAAGAGAACCAACAAGG - Intronic
1050265520 9:3885407-3885429 CTGCATGAGGAGCAGCACCATGG - Intronic
1050368599 9:4897479-4897501 CTGCAGTAACAAAAACAGCATGG - Intergenic
1050392020 9:5154083-5154105 CTACAGTAACAGAAACAGCATGG + Intronic
1050856573 9:10364526-10364548 ATGCATAAAGAGAAGCAGCCTGG - Intronic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1053616862 9:39776228-39776250 CCCCATGAAGTGAAGCAGCAAGG + Intergenic
1053875041 9:42535564-42535586 CCCCATGAAGTGAAGCAGCAAGG + Intergenic
1053897594 9:42759046-42759068 CCCCATGAAGTGAAGCAGCAAGG - Intergenic
1054236655 9:62566155-62566177 CCCCATGAAGTGAAGCAGCAAGG - Intergenic
1054267306 9:62931210-62931232 CCCCATGAAGTGAAGCAGCAAGG - Intergenic
1054550794 9:66600663-66600685 CCCCATGAAGTGAAGCAGCAAGG - Intergenic
1055817721 9:80226829-80226851 CTACAATAACAAAAGCAGCATGG - Intergenic
1056194814 9:84219071-84219093 CTGCAGGCACCGCAGCAGCAAGG - Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1058022584 9:100104575-100104597 CTCCATTAACGGCAGCAGCATGG - Exonic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1058463420 9:105204755-105204777 ATGCAGGAACAGGAGCAGAAAGG - Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059655447 9:116353541-116353563 CTGCATGAACACCACCAGCTGGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1062681814 9:137786193-137786215 CTGCATGGACAGCAGCACCAAGG - Intronic
1186084072 X:5967561-5967583 GTTCATGCACAGAAGCAGAAAGG - Intronic
1186407815 X:9318933-9318955 ATGCATGAACGGGACCAGCAGGG + Intergenic
1186693241 X:12002277-12002299 CTACATGAACAGAAGCAGGCCGG - Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1188733474 X:33682347-33682369 CTGCATTAACAGTAGGTGCATGG + Intergenic
1188918152 X:35937421-35937443 CTGGAGGAACAATAGCAGCAGGG - Intronic
1189081293 X:37975368-37975390 CAGCATGTACTGGAGCAGCAGGG + Intronic
1189592065 X:42524075-42524097 CTCCATGAAAAGCAGCATCAGGG - Intergenic
1190603411 X:52115866-52115888 CTACAGTAACAAAAGCAGCATGG + Intergenic
1192165804 X:68827030-68827052 GTGCATGGACAGCAGCAGCCTGG - Intergenic
1194216961 X:91142398-91142420 CTGCAGTAACAAAAACAGCATGG + Intergenic
1194425727 X:93735178-93735200 CTGCAATAACAAAAACAGCATGG - Intergenic
1195419757 X:104661348-104661370 CACCATAAACAGAAGCAGTAAGG - Intronic
1195434085 X:104822636-104822658 CTACATTAACAAAAACAGCATGG - Intronic
1196502206 X:116398016-116398038 CTACAGGAACTGAAACAGCATGG - Intergenic
1197123865 X:122921769-122921791 CTACAGTAACAGAAACAGCATGG - Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic