ID: 1163751064

View in Genome Browser
Species Human (GRCh38)
Location 19:19078136-19078158
Sequence CTGTATATGGGGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163751053_1163751064 17 Left 1163751053 19:19078096-19078118 CCATGATATGCTGCTGGGCAGGT 0: 1
1: 0
2: 1
3: 19
4: 122
Right 1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG 0: 1
1: 0
2: 5
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163751064 Original CRISPR CTGTATATGGGGAGGCTGGA GGG Intronic
900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG + Intergenic
901385422 1:8905278-8905300 CTGTATCTGGCCAGGCGGGATGG - Intergenic
901820296 1:11824835-11824857 CTCTATATAGGGTGGCTGGGTGG + Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
903578609 1:24354435-24354457 CTGGACATGGGGGAGCTGGACGG + Intronic
904111619 1:28130652-28130674 CTTTTTGTGGGGAGGCTGGGTGG - Intergenic
904363985 1:29999005-29999027 CTGAATGTGGGAAGGCTGGTAGG + Intergenic
904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG + Intergenic
905410392 1:37764578-37764600 CGGAATATGGGGAGACGGGATGG - Intronic
906532239 1:46530533-46530555 CTACACATGGTGAGGCTGGAGGG - Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG + Intergenic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
907964922 1:59319733-59319755 CTGTATTAGGCGGGGCTGGATGG + Intronic
908796840 1:67838546-67838568 CTGTATATCTGGAGGCTAGATGG - Intergenic
909240304 1:73204966-73204988 CCCTATATGGGGTGACTGGATGG + Intergenic
911242767 1:95483469-95483491 CTGGAGCTGGGGATGCTGGATGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913257315 1:116965138-116965160 GTGTATTTGAGGAGCCTGGAAGG - Intronic
914394932 1:147256679-147256701 CTGTTTATGGGTAGGCGGCATGG + Intronic
916420753 1:164635616-164635638 TGATATATGGCGAGGCTGGATGG - Intronic
916521483 1:165567341-165567363 AGGGATATGGGGAGGATGGAGGG + Intergenic
919464303 1:197911885-197911907 CTGATTATTGAGAGGCTGGAAGG + Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920516261 1:206586497-206586519 CTGCATGTTGGGAGGCTGGGTGG + Intronic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923291611 1:232551620-232551642 CTCTGTCTGCGGAGGCTGGAGGG - Intronic
923956952 1:239032941-239032963 CTGAAAATGGGGTGGGTGGAAGG + Intergenic
924775566 1:247112734-247112756 CTGTAGGTGGGGAGGCAGGCAGG + Intergenic
1062948357 10:1477398-1477420 CTGTATAGGGTCATGCTGGAGGG - Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1064128042 10:12681347-12681369 GTGATCATGGGGAGGCTGGAAGG - Intronic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1069649597 10:70035805-70035827 CTGAATATGGAAAGGCTGCATGG - Intergenic
1069707151 10:70466023-70466045 CTGTCACCGGGGAGGCTGGAGGG + Intergenic
1070335654 10:75453023-75453045 GTATATTTGGGGTGGCTGGAGGG + Intronic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1073059193 10:100723462-100723484 GTGTATATGGGGAGCCTGTGTGG + Intergenic
1074910968 10:117908486-117908508 CTGCTTATGGGGAGGGAGGAAGG - Intergenic
1075895345 10:125990109-125990131 CTGTACCTGGGGAGGAGGGAAGG - Intronic
1076668219 10:132104794-132104816 TTGGACATGGTGAGGCTGGATGG - Exonic
1076867529 10:133175370-133175392 TTGTATGTGTGGAGGATGGATGG + Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1078160673 11:8837236-8837258 GTGTATTTGGGGAGGAGGGATGG + Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1079515609 11:21264439-21264461 CAGGAGATGGGAAGGCTGGAGGG + Intronic
1080407252 11:31990537-31990559 GTGTAGCTGGGGAGGCAGGATGG - Intronic
1082792032 11:57352771-57352793 GGGTATTTGGGGAGGCAGGACGG + Intronic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083839287 11:65294567-65294589 CCGTTTATGGAGAGGCTGCAGGG - Exonic
1083868415 11:65471469-65471491 CTGTATTTGGAGAGGCTGAAGGG + Intergenic
1084942074 11:72618278-72618300 CTGGGAGTGGGGAGGCTGGAGGG - Intronic
1085341233 11:75732890-75732912 CTGTTTGTGGGTAGGCTGGAGGG - Intronic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1086597320 11:88588543-88588565 CTGTATATGGGTAAGCAGGTAGG - Intronic
1089055578 11:115582232-115582254 CTGGAGGTGGGGAGGCTGGGTGG + Intergenic
1090473074 11:126997110-126997132 CTGTGCATGTGCAGGCTGGATGG + Intronic
1091444428 12:535443-535465 CTGGCTTTGAGGAGGCTGGATGG - Intronic
1091875314 12:3928929-3928951 CTGTATATGGGGAGGTGGGCAGG - Intergenic
1092164322 12:6333661-6333683 CTGTCTATGTGCAGGCTGGTGGG - Intronic
1092261814 12:6956883-6956905 CTGTGTAGGGGGAGCCTGCAGGG - Intronic
1092667588 12:10820889-10820911 CTCAAAAGGGGGAGGCTGGAAGG - Intergenic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1094524917 12:31225180-31225202 CTGGAGATGGGGTGGCGGGAGGG + Intergenic
1096427774 12:51518583-51518605 GTGTATATGGAGGGACTGGAGGG + Intergenic
1098529310 12:71522305-71522327 CTGAATATGGGGAGACAAGATGG + Intronic
1100181170 12:92087982-92088004 CTGTATCTGGGGGGGCAGGGTGG + Intronic
1101140631 12:101792079-101792101 GTGTCTATGGGGAGGCGGGGCGG + Intronic
1103627995 12:122235205-122235227 CAGTATATTGGGAGGCTGAAGGG - Intronic
1103917347 12:124382748-124382770 CTGAATATGGGGCTGCTGAATGG + Intronic
1104037064 12:125104913-125104935 CTGCTTCTGGGGAGGCTGTATGG + Intronic
1106801121 13:33256944-33256966 CTGTATATAGTGAGTCTGTAAGG - Intronic
1107169003 13:37317402-37317424 CTGTAGGTGGGGAGGCTTCAGGG + Intergenic
1109019775 13:57074391-57074413 CTGTATTTTGGGAGGCTGAGGGG + Intergenic
1112308317 13:98295362-98295384 GTGGATATGGGGAGGATGAAGGG + Intronic
1112809286 13:103199099-103199121 CTGTAGATGGGCAAGCGGGAGGG + Intergenic
1113201432 13:107870311-107870333 CTGTATATTGGGAGGGGGTAAGG + Intergenic
1113678529 13:112225486-112225508 CTGTAAATGAGGACCCTGGAGGG - Intergenic
1114356210 14:21912157-21912179 CTGTTTCTGGGGAGGCTTCAGGG + Intergenic
1116626694 14:47274079-47274101 CTCTAAATGGGTAGGTTGGATGG - Intronic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122826822 14:104374610-104374632 GTGGGTATGGGGAGGCCGGAGGG + Intergenic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1127431961 15:58919344-58919366 CAGCATTTTGGGAGGCTGGAGGG + Intronic
1129460195 15:75696712-75696734 CTGTTTATGGGGAGGAAGGGTGG - Intronic
1129677740 15:77641605-77641627 CTGTAATTGGGGAGGGTGTAGGG - Intronic
1131873758 15:96783945-96783967 GTGCACTTGGGGAGGCTGGAAGG + Intronic
1132484466 16:183278-183300 CTGGAGATGTGGAGGTTGGAGGG + Intergenic
1132804870 16:1770828-1770850 CTGAACAGGGGGAGGCCGGACGG + Intronic
1133281980 16:4671760-4671782 CTGTCTCTGGGGAGGCGGGCAGG - Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1135836446 16:25830071-25830093 CAGTATTTTGGGAGGCTGAAGGG - Intronic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139712985 16:68790626-68790648 CTGCAGAGGCGGAGGCTGGAGGG - Intronic
1142364808 16:89644620-89644642 TTGATTTTGGGGAGGCTGGAGGG + Exonic
1142782213 17:2190125-2190147 CTGCCTATGGGGAGGGTGAAGGG - Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1145285147 17:21500143-21500165 CTGAATACGTGGAGTCTGGAGGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149681448 17:58510322-58510344 CTGCATATTGGGAGACTGGCAGG - Intronic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1150486478 17:65547163-65547185 AAGTAAATGGGGAGGCTGCAGGG + Intronic
1150530263 17:65973712-65973734 CTGGATATGGGGAGGTGGAAAGG + Intronic
1151230105 17:72678370-72678392 ATGGAAATGTGGAGGCTGGAGGG + Intronic
1152067143 17:78118059-78118081 CTGTAAATGAGGAGGCTGCAGGG - Intronic
1152126976 17:78453087-78453109 CTCCAGATGGGGAGGCTTGAAGG - Intronic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1156469863 18:37370478-37370500 CAGGATGTAGGGAGGCTGGATGG - Intronic
1156778470 18:40821947-40821969 CTGGAGCTGGGGAGGCAGGATGG + Intergenic
1157443197 18:47725720-47725742 ATGTGTATAAGGAGGCTGGAGGG - Intergenic
1158008511 18:52701429-52701451 CTGTCTATGGGTAGGAAGGAAGG - Intronic
1160006577 18:75073083-75073105 CTGGATATGGGGAGGCTGGTGGG + Intergenic
1160058237 18:75506638-75506660 ATGTATCTGGGGAGACTGGCTGG - Intergenic
1160953917 19:1680942-1680964 AGGCAGATGGGGAGGCTGGAAGG + Intergenic
1162751240 19:12830581-12830603 CTGAATGCGGGGAGGCGGGAAGG - Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1164402634 19:27912129-27912151 CTAGAGATGGGGAGGCAGGAAGG + Intergenic
1164455612 19:28404138-28404160 GTGTACATGGGGAGGCTGGATGG + Intergenic
1165112473 19:33510415-33510437 GTATATATGCAGAGGCTGGAAGG + Intronic
1165339931 19:35204179-35204201 CTGCATGTAGGGAGGCTGGACGG - Intergenic
1166602115 19:44105667-44105689 CTCAAAATGGGGAGGGTGGAAGG - Intronic
1167245942 19:48373269-48373291 CTGGAGGTGGGGAGGCTGGGAGG + Intronic
925137162 2:1529925-1529947 GGGGATATGGGGAGGCTGCAAGG - Intronic
930002252 2:46869321-46869343 CTGGAGTTGGGGACGCTGGAAGG - Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
934852117 2:97707959-97707981 CTGGATGTGGGGTGGCTGTAGGG + Intergenic
935390846 2:102551194-102551216 CTTTATAAGGGGAGGCAGCAGGG + Intergenic
937927229 2:127176637-127176659 GTGTAGATGGGGAGGAGGGAGGG + Intergenic
938015616 2:127864699-127864721 CTTCATCTGGGGAGGCTGCAGGG + Exonic
940378301 2:152983457-152983479 ATGTATATGGGGAGGTTGGAGGG + Intergenic
941641853 2:167997287-167997309 CTGTATTTGGGGAAACTGCAGGG + Intronic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
944314848 2:198273177-198273199 CTGTGTCTGCGGAGGCGGGATGG + Intronic
944902497 2:204230084-204230106 CTGTATATGGGAAGTAGGGAAGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
948840142 2:240644792-240644814 GTGTAGCTGGGGAGGCTGAAAGG - Intergenic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1171084545 20:22225473-22225495 GTGGAAATGGGGAGGATGGATGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1178149648 21:29779614-29779636 CTATATAAGGGGAGGCTTTATGG + Intronic
1179412392 21:41172015-41172037 CTTCATTTGGGGAGCCTGGATGG - Intronic
1181844593 22:25696855-25696877 TTGTATTTGTGGAGCCTGGATGG + Intronic
1183177289 22:36233287-36233309 GTGTACAGAGGGAGGCTGGAGGG + Intronic
1183623726 22:38989353-38989375 CAGTATATGGGGAGCAGGGAAGG + Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1185015931 22:48342602-48342624 CTGTATCTTGGGTGGCAGGATGG - Intergenic
950539994 3:13606451-13606473 TTGTGACTGGGGAGGCTGGAAGG - Intronic
954148396 3:48645639-48645661 CTGTCTCTGTAGAGGCTGGAGGG - Exonic
954197181 3:49003751-49003773 CTCTATATAGCCAGGCTGGAAGG + Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
957694205 3:83613104-83613126 CTGTTTCTGGGGAGGCTTCAGGG + Intergenic
957983963 3:87548402-87548424 CTGGATATGGGAAGGAAGGAAGG + Intergenic
960360252 3:116702492-116702514 CTGTCTCTGGGGATGCTGGTTGG - Intronic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
961339967 3:126211559-126211581 GTGGATAGGGGCAGGCTGGAGGG - Intergenic
962708487 3:138067054-138067076 CTGGATTTGGGGAGGCTGGAGGG + Intronic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
965229941 3:166037694-166037716 TTGTATATGGGGAGCCAAGATGG + Intergenic
965355617 3:167669486-167669508 TTGTATTTTGGGAGGATGGAGGG + Intergenic
965702364 3:171471106-171471128 CAGTATATGGGGAATCTGGTGGG - Intergenic
968089812 3:195892948-195892970 TTGTGTATGGGGAGGCAGGGGGG - Intronic
969651687 4:8471742-8471764 CAGGGTATGGGGAGGCAGGAGGG + Intronic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970828079 4:20302460-20302482 ATGTCTATGGGGGGGATGGAAGG + Intronic
972278562 4:37581970-37581992 CTGTGTGTGGGTAGGCTGGGGGG + Intronic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
974499690 4:62684149-62684171 CTGTAGCTGGGGAGACTGGATGG + Intergenic
979531364 4:121772274-121772296 CTGTATATGGCAGGGATGGAGGG - Intergenic
979708300 4:123747600-123747622 CTGCATATGGTGGTGCTGGAAGG + Intergenic
981425881 4:144602511-144602533 TTGTGTACGGGGAGTCTGGAGGG + Intergenic
984695489 4:182775313-182775335 GTGCAGCTGGGGAGGCTGGAGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986737761 5:10680851-10680873 TTGTTTATGGGGAGTCTGGTTGG - Exonic
990662308 5:58029771-58029793 CTGGAGATGGGGAAGCTGTATGG + Intergenic
990699500 5:58460110-58460132 TTATATACGGGGAGGCGGGAAGG + Exonic
991384861 5:66075163-66075185 CTGTGTATATGGAGGCTGGTGGG - Exonic
991991432 5:72343838-72343860 CTCAATATGGGCAGGCTGAATGG - Intronic
994696633 5:103079873-103079895 CTGGATCCAGGGAGGCTGGATGG - Intergenic
995168557 5:109078199-109078221 CTGTATATAGGGAGTATAGAGGG - Intronic
996303322 5:122015914-122015936 AAGTATATGAGGAGGATGGAGGG - Intronic
997286344 5:132681415-132681437 ATGTAAATGGAGAGGCAGGAAGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
1002853316 6:1015880-1015902 CTGTATAAGGGGTGGCTGCAGGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1005412497 6:25565163-25565185 CCCAATTTGGGGAGGCTGGAAGG + Intronic
1005557120 6:26997794-26997816 CTGCTTCTGGGGAGGCTGAAGGG - Intergenic
1006321881 6:33323975-33323997 TTGTGTTTAGGGAGGCTGGAGGG + Intronic
1006607178 6:35266447-35266469 CTGAAATTGGGGAGCCTGGAAGG + Intronic
1008067156 6:47061872-47061894 CTGTAAATGGGGAGGGTGCTGGG + Intergenic
1008760619 6:54847719-54847741 CTTTATAGGAGGAGGCTGGGAGG + Intronic
1011472636 6:87723192-87723214 CAGTATATGGGTAGGGAGGAGGG - Intergenic
1011480635 6:87790098-87790120 CTGGATATAGGGAGAATGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014623994 6:123703674-123703696 ATGTCTATGGGAAGGCAGGAAGG + Intergenic
1014628993 6:123766465-123766487 ATGTTTCTGGGGAGGCTGCAGGG - Intergenic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1017507870 6:155085020-155085042 CTGTAAATGGAGACTCTGGAGGG + Intronic
1019292901 7:258946-258968 CTGTAACTGGGGTGGCAGGACGG - Intronic
1020407363 7:7852722-7852744 CTGAATATGTGGAGGCTGACAGG - Intronic
1020792028 7:12639377-12639399 CTGCATATAGGGAGGCCGAAAGG - Intronic
1022310745 7:29194301-29194323 CTGGACAGGGGGAGGCGGGACGG - Intronic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1026637796 7:72099184-72099206 CAGTATCTGGGCAGGCAGGATGG - Intronic
1029384622 7:100235220-100235242 CTGTAGATGAGGGGGCTGCAGGG - Intronic
1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG + Exonic
1032442937 7:131956039-131956061 GTGAATGTGGGGAGGCAGGAAGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1033735972 7:144222224-144222246 CTGAATATGTGAAGGCAGGAGGG + Intergenic
1033747079 7:144328728-144328750 CTGAATATGTGAAGGCAGGAGGG - Intergenic
1035520324 8:271012-271034 CTCTGTGTGGTGAGGCTGGAGGG - Intergenic
1037920284 8:22801012-22801034 CTGCCCTTGGGGAGGCTGGATGG - Intronic
1038160403 8:25031642-25031664 CTGTAGATGGGGAGTCTGCACGG - Intergenic
1038310572 8:26443286-26443308 CTGTATATGGGAGGGCAGGTAGG + Intronic
1039080735 8:33731777-33731799 GTGTATATGTTGAGGCTGTAGGG + Intergenic
1040514167 8:48120821-48120843 CAGTATCTGGGGAGACTTGAGGG - Intergenic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1044748552 8:95394721-95394743 GGAAATATGGGGAGGCTGGAGGG - Intergenic
1045234175 8:100335665-100335687 CTTTATCTGGGGAGGCTAGATGG + Intronic
1045358695 8:101412432-101412454 CCTGATATGGGGAGACTGGAAGG - Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047563472 8:126014043-126014065 GTGTATGTGGGGAGGTTGAAGGG + Intergenic
1049592192 8:143467799-143467821 CTGTATGTGAGGGGGCTGGGTGG - Intronic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1053314686 9:37041351-37041373 CTGGAAAGGGGGAGGCTGGAGGG + Intergenic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1055042966 9:71895220-71895242 CTGTAAATGGGGTGGGAGGAGGG - Intronic
1059742891 9:117170249-117170271 TTGTATTTGGAGTGGCTGGAAGG - Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1188981361 X:36730043-36730065 GTGTATATGTGGAGGGTGCAGGG - Intergenic
1191972387 X:66831633-66831655 GTGTATGTGGGGCGGGTGGAGGG - Intergenic
1192187078 X:68954814-68954836 GTGGATCTGGGGAGGGTGGATGG - Intergenic
1192473793 X:71421494-71421516 TAGTATATGTGAAGGCTGGAAGG + Intronic
1192698308 X:73442411-73442433 GTGTATATGAGGAGGCAGGTAGG - Intergenic
1192951932 X:76026425-76026447 CTGGAGCTGGGGAGGCTGGACGG + Intergenic
1193365174 X:80623244-80623266 CTGGAGCTGGGGAGACTGGATGG - Intergenic
1193595874 X:83444477-83444499 CTGTATGTAGGGATGTTGGAGGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198728378 X:139700995-139701017 GTGGATCTGGGGAGGCAGGAGGG - Intronic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1200787513 Y:7273659-7273681 CGGAAGATGGGGAGGCTGGGTGG - Intergenic