ID: 1163754059

View in Genome Browser
Species Human (GRCh38)
Location 19:19096154-19096176
Sequence GCGATTGCATGAGGATGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163754045_1163754059 30 Left 1163754045 19:19096101-19096123 CCTGCCATTCCGAGCAGGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 106
1163754047_1163754059 26 Left 1163754047 19:19096105-19096127 CCATTCCGAGCAGGCCTGGTATG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 106
1163754052_1163754059 12 Left 1163754052 19:19096119-19096141 CCTGGTATGGGTAATGGTGTGAA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 106
1163754050_1163754059 21 Left 1163754050 19:19096110-19096132 CCGAGCAGGCCTGGTATGGGTAA 0: 1
1: 0
2: 1
3: 3
4: 104
Right 1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163754059 Original CRISPR GCGATTGCATGAGGATGCTG AGG Exonic
900237485 1:1599736-1599758 GCCACTGCAGGAGGACGCTGCGG + Exonic
906097792 1:43235977-43235999 GCGTCAGCATGAGGCTGCTGGGG + Intronic
907350447 1:53825337-53825359 GTGATGGCATGTGGAGGCTGAGG + Intronic
915354427 1:155247696-155247718 GCCAGTGCAAGAGGATGCTGGGG + Exonic
918685350 1:187408265-187408287 GCCCGTGCATGAGGATGATGGGG - Intergenic
920428051 1:205894538-205894560 GAGATTCCAGGAGGATCCTGAGG + Intergenic
922945466 1:229510089-229510111 GCTTTTACATTAGGATGCTGGGG - Intergenic
923470538 1:234286626-234286648 GAGAGTCCATGAGGATGATGAGG + Intronic
923615999 1:235537918-235537940 GTTGTTGCATGAGGATCCTGTGG + Intergenic
923866941 1:237949609-237949631 GTTGTTGCATGAGGATCCTGTGG + Intergenic
1063062284 10:2568388-2568410 GCGATTGCTAGCGGTTGCTGGGG - Intergenic
1067309229 10:45096527-45096549 TATATTGCATGATGATGCTGAGG - Intergenic
1070249970 10:74765155-74765177 ACAATTGCGTGAGGGTGCTGTGG - Intergenic
1073072673 10:100804617-100804639 GTGATTGCATGAGGACTGTGAGG - Intronic
1074794255 10:116925169-116925191 GTGTTTCCATGAGGATGTTGTGG + Intronic
1075549864 10:123384153-123384175 GAGATAGCATGACGTTGCTGTGG - Intergenic
1075668270 10:124245833-124245855 GGGACTGCAGGAGGATGCTGGGG + Intergenic
1076303885 10:129449684-129449706 ACAATTGCATGTGGTTGCTGAGG - Intergenic
1077060742 11:616918-616940 GAGATTGCCTGGGGAGGCTGAGG - Exonic
1077501377 11:2911163-2911185 TCTATTGCATGAGGCTTCTGCGG - Intronic
1078923975 11:15857760-15857782 GCCATTTCATAAGGAGGCTGTGG + Intergenic
1080703826 11:34669275-34669297 GCTTTTTCATGAGGAAGCTGAGG - Intergenic
1081512926 11:43794630-43794652 GCCATTGGATGAGGATGCTACGG + Intronic
1084067691 11:66714777-66714799 GTGATGGCATGAGGACACTGGGG + Intronic
1090445756 11:126763429-126763451 GAGAGGGCATGAGGATGCAGTGG + Intronic
1091179548 11:133591369-133591391 TCGATGGAATGAGGATGGTGGGG - Intergenic
1092768704 12:11877385-11877407 GGGATTGCATGAAAGTGCTGGGG + Intronic
1096717296 12:53499298-53499320 GTGATGGCGTGGGGATGCTGAGG - Intronic
1099785111 12:87252350-87252372 GCATTTGCATCAGGAAGCTGAGG - Intergenic
1105038769 12:132945790-132945812 GCTATTGCCTGTGGATGCAGTGG + Exonic
1117336242 14:54759414-54759436 GCGTGGGCATGAGGATCCTGGGG - Intronic
1123788633 15:23697215-23697237 GAGATTCCAGGAGGATTCTGAGG - Intergenic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1130702858 15:86202879-86202901 AAGATTGCATAAGGAGGCTGAGG + Intronic
1134134803 16:11671171-11671193 GGGGTTGTTTGAGGATGCTGGGG + Intronic
1136786441 16:32938022-32938044 GGGAGTGGATGAGGACGCTGCGG + Intergenic
1137537228 16:49336593-49336615 CCTATTGTATGAAGATGCTGGGG - Intergenic
1138502756 16:57458248-57458270 GAGGGAGCATGAGGATGCTGAGG - Exonic
1139649088 16:68353135-68353157 TCCAGTTCATGAGGATGCTGGGG - Intronic
1141226614 16:82122246-82122268 GTTATTGTATGAGGATTCTGTGG + Intergenic
1143065079 17:4240790-4240812 TAGATTGCATTAGGATGCTCAGG - Intronic
1144801390 17:17930529-17930551 CTGATTGCAAGAGGCTGCTGGGG - Intronic
1148758215 17:49985727-49985749 GGGATTGCAGGAGAAGGCTGGGG - Intergenic
1149511605 17:57246707-57246729 GCCATGTCATGAGGATGCTCAGG - Intergenic
1151494808 17:74453047-74453069 ACGATTGGAAGAGGATGCTAAGG + Intergenic
1155770498 18:29692098-29692120 GGGATTGCATGAGGAACATGTGG + Intergenic
1158858588 18:61569719-61569741 GGGATTGCATCAGGTTCCTGGGG - Intergenic
1161120739 19:2524924-2524946 GGGAGTGCATGTGGATGCTTGGG + Intronic
1161645900 19:5453281-5453303 GGGATGGCATGGAGATGCTGGGG - Intergenic
1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG + Exonic
925122156 2:1427661-1427683 GCGTCTGCATGAGGAGGCTGTGG + Intronic
928208952 2:29309420-29309442 CCCATTGCATGATGAAGCTGAGG - Intronic
928979974 2:37127470-37127492 GCCATGAGATGAGGATGCTGAGG - Intronic
929287284 2:40149712-40149734 GCTACTGCACGAGGCTGCTGTGG + Intronic
930183623 2:48389070-48389092 GAGATTCCAGGAGGATCCTGAGG + Intergenic
932413945 2:71562704-71562726 GCGGTTGCTGGAGGAAGCTGTGG + Intronic
935825910 2:106949180-106949202 GCAGTTGCATGAGGAGGCTGAGG + Intergenic
936559928 2:113528611-113528633 GCTATTGCATGTGCATTCTGGGG - Intergenic
936799928 2:116254525-116254547 GAGATTCCAGGAGGATCCTGAGG + Intergenic
940562261 2:155313538-155313560 GTTGTTGCATGAGGATTCTGTGG - Intergenic
947595524 2:231409331-231409353 GAGATTGCCTCGGGATGCTGAGG + Intergenic
948943999 2:241210225-241210247 GCCATGGCCTGAGGGTGCTGGGG + Intronic
1169019782 20:2321025-2321047 GAGATTGCATGAGGAGCCAGGGG - Intronic
1172089016 20:32414120-32414142 GAGATTTCATGATAATGCTGTGG + Intronic
1172583570 20:36066485-36066507 GCCATTGCATGTGGTTGGTGTGG - Intergenic
1175039718 20:56037213-56037235 TCCATTTTATGAGGATGCTGAGG - Intergenic
1175196665 20:57248527-57248549 GAGATTGCATGAGGATGAACTGG + Intronic
1176860851 21:14010982-14011004 CCAGTTGCATGAGGGTGCTGAGG + Intergenic
1178818077 21:35949898-35949920 GAGATGGGATGAGGATGGTGCGG - Intronic
1181338801 22:22162262-22162284 GCTGGGGCATGAGGATGCTGAGG - Intergenic
1184810766 22:46830174-46830196 GGGAATGCATGGGGACGCTGAGG + Intronic
949892203 3:8741781-8741803 GGGATTGCTTGAGGATGCGGGGG - Intronic
952623968 3:35381616-35381638 GCTATTGAATGTGGAAGCTGAGG + Intergenic
961181489 3:124881610-124881632 TTGTTTGCATGAGGAAGCTGAGG - Intronic
970444283 4:16110821-16110843 GCCCTTGGATGAGGAAGCTGAGG - Intergenic
971368952 4:26000197-26000219 GCAATTGCATTATGATGCTGAGG - Intergenic
976528877 4:86127028-86127050 GAGATTTTATGAGGATGATGAGG - Intronic
977443360 4:97098482-97098504 GAGATTCCAGGAGGATCCTGAGG - Intergenic
978376473 4:108079445-108079467 GTGATTGCCTTAGGATACTGAGG - Intronic
979982395 4:127272995-127273017 GAGATTCCAGGAGGATCCTGAGG - Intergenic
980346890 4:131633505-131633527 GCGCTTGCATCAGCATGCTCTGG + Intergenic
982495871 4:156091571-156091593 GCACTTTCATGAGGATGCTCTGG + Intergenic
983156832 4:164358246-164358268 GGCATTCCAAGAGGATGCTGTGG - Intronic
984672096 4:182502255-182502277 GGCCTTTCATGAGGATGCTGGGG + Intronic
989534750 5:42550683-42550705 GAGTTTGAATGGGGATGCTGAGG + Intronic
993077989 5:83259367-83259389 GTTATTGAATGATGATGCTGTGG + Intronic
999241758 5:150132009-150132031 GGCCTTCCATGAGGATGCTGAGG - Exonic
1001544968 5:172565369-172565391 AGGACTGAATGAGGATGCTGGGG + Intergenic
1002843732 6:927403-927425 GAGATTCCATGAGGCTCCTGAGG + Intergenic
1002954639 6:1850090-1850112 GAGATTGCATGAGGAGGATTAGG - Intronic
1003166908 6:3687572-3687594 GCTATTGCATGAGGACACTGAGG - Intergenic
1006518430 6:34557248-34557270 CCGAGAGCATGAGGATTCTGGGG + Intergenic
1008920427 6:56838328-56838350 CCAATTGCATGAAGATGCTTTGG + Intronic
1013739331 6:113264941-113264963 GAGATTCCAGGAGGATCCTGAGG - Intergenic
1016736590 6:147486247-147486269 GTGATTGCCTTAGGATGGTGAGG - Intergenic
1019234069 6:170594669-170594691 GAGATTCCAGGAGGATCCTGAGG - Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1034785977 7:153925920-153925942 GTGATGGCATGAGGAGGGTGAGG + Intronic
1035381681 7:158444914-158444936 GCGTTTTCAAGAGGATGCAGGGG - Intronic
1036993926 8:13632356-13632378 GGAAATGCATAAGGATGCTGAGG - Intergenic
1042866108 8:73357897-73357919 GCAATTTCATGAGGCTGCAGGGG - Intergenic
1044805485 8:96004553-96004575 GCTGGTGCCTGAGGATGCTGAGG + Intergenic
1046080309 8:109362769-109362791 GCGGTTGCATGACGATCCTGGGG + Intronic
1047960778 8:130010270-130010292 GTGAGAGCAGGAGGATGCTGAGG - Intronic
1049351347 8:142166433-142166455 GCAATGGCATGGGGAAGCTGGGG - Intergenic
1049892938 9:87753-87775 GCTATTGCATGTGCATTCTGGGG + Intergenic
1051025676 9:12607853-12607875 GCGACTACATGAAGAGGCTGTGG - Intergenic
1052952705 9:34226311-34226333 GCAATTGCTTGAGGAGGCAGAGG - Intronic
1061257790 9:129462697-129462719 GTGGTTGCCTGGGGATGCTGGGG + Intergenic
1061487966 9:130929830-130929852 GCGGGTCAATGAGGATGCTGAGG + Exonic
1062208329 9:135349324-135349346 GCGGTCTCATGAGGAAGCTGGGG + Intergenic
1186524619 X:10236966-10236988 GCGATTGCATGATGCTCATGTGG + Exonic
1192432993 X:71125257-71125279 GCTTTAGCATGTGGATGCTGAGG + Intronic
1196472044 X:116039649-116039671 GAGATTCCAGGAGGATCCTGAGG + Intergenic
1200214569 X:154361925-154361947 GCTGCTGCATGAGGAGGCTGGGG + Intronic
1201958926 Y:19657228-19657250 GAGATTCCAGGAGGATCCTGAGG - Intergenic