ID: 1163755078

View in Genome Browser
Species Human (GRCh38)
Location 19:19101748-19101770
Sequence ACATGTGATCAGAGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 253}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755078_1163755085 27 Left 1163755078 19:19101748-19101770 CCCTCTGACCTCTGATCACATGT 0: 1
1: 0
2: 1
3: 31
4: 253
Right 1163755085 19:19101798-19101820 GCTCAGCTCCCTGCTGTCTGGGG 0: 1
1: 0
2: 2
3: 46
4: 417
1163755078_1163755081 -1 Left 1163755078 19:19101748-19101770 CCCTCTGACCTCTGATCACATGT 0: 1
1: 0
2: 1
3: 31
4: 253
Right 1163755081 19:19101770-19101792 TTCTGTTGCAGCGTGACCACAGG 0: 1
1: 0
2: 1
3: 6
4: 136
1163755078_1163755083 25 Left 1163755078 19:19101748-19101770 CCCTCTGACCTCTGATCACATGT 0: 1
1: 0
2: 1
3: 31
4: 253
Right 1163755083 19:19101796-19101818 GTGCTCAGCTCCCTGCTGTCTGG 0: 1
1: 1
2: 1
3: 27
4: 294
1163755078_1163755084 26 Left 1163755078 19:19101748-19101770 CCCTCTGACCTCTGATCACATGT 0: 1
1: 0
2: 1
3: 31
4: 253
Right 1163755084 19:19101797-19101819 TGCTCAGCTCCCTGCTGTCTGGG 0: 1
1: 0
2: 5
3: 40
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755078 Original CRISPR ACATGTGATCAGAGGTCAGA GGG (reversed) Intronic
902036962 1:13464861-13464883 AGAAGTAATTAGAGGTCAGATGG + Intergenic
902231023 1:15027725-15027747 ACATGCGCTCAGAGGTGAGGAGG - Intronic
902741899 1:18444672-18444694 ACAGGAGTCCAGAGGTCAGATGG + Intergenic
903353203 1:22730592-22730614 ACGTTTGAGCAGAGGCCAGAAGG + Intronic
904257804 1:29267470-29267492 ACATTTGAGCAGAGATCTGAAGG + Intronic
905421478 1:37848790-37848812 ACAAGCCATCAGAGTTCAGAAGG + Intronic
905473834 1:38212054-38212076 ACCTCTGAGCAGAGGTCTGAGGG - Intergenic
906059503 1:42939228-42939250 ACATGTGAAGAGAGGACAGAAGG - Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
907322522 1:53614336-53614358 ACATTTGAACAGAGGCCTGAGGG + Intronic
908403815 1:63794569-63794591 ACCTGTTATCAGAGGCCAGAGGG + Intronic
910647150 1:89525650-89525672 GCAGGTGCTGAGAGGTCAGAAGG + Intronic
912746605 1:112250436-112250458 ACATGTGATCAGAGGCGAGGTGG - Intergenic
913026230 1:114844048-114844070 AAATGTCATTAGAAGTCAGAAGG - Intergenic
913677595 1:121156185-121156207 AAAAGAGATCAGTGGTCAGAAGG + Intergenic
914456703 1:147843275-147843297 ACATGTGCAAAGAGGTCACATGG + Intergenic
915052834 1:153094376-153094398 ACCTGTGATCATAGGTTTGATGG - Intronic
918711117 1:187731554-187731576 ACATTTGAGCAGAGATCTGAAGG - Intergenic
920779371 1:208973701-208973723 ATATGTGATTAGAGTTCAAATGG - Intergenic
921178865 1:212616004-212616026 ACTTTTGAGCAGAGGTCAAAAGG + Intronic
921333309 1:214062156-214062178 ACATTTAATCAGAGACCAGAAGG - Intergenic
921490161 1:215765641-215765663 CCATGTGTTCAGAGGTGGGATGG - Intronic
921709736 1:218361870-218361892 ATATGTGAGCAGATGTCAGCTGG + Intronic
922664891 1:227460189-227460211 AGATGAGATCATAGGTGAGAAGG + Intergenic
922788666 1:228297280-228297302 ACATCTGGTCAGACCTCAGATGG - Intronic
924214872 1:241810636-241810658 ACATTTGAACAGAGATCTGAAGG - Intergenic
1064057066 10:12106630-12106652 ACCTGTGCTCAGGGGTCAGTAGG + Intronic
1064501456 10:15977819-15977841 CCATGGGATCAGAGGAGAGAAGG - Intergenic
1064996253 10:21299410-21299432 ACATTTGATCAGAGGAGAGGTGG + Intergenic
1066002372 10:31116505-31116527 AAATATGATCAGACCTCAGAAGG - Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1068547265 10:58361581-58361603 ACATCTGATCAAAGGTGAAATGG - Intronic
1070623982 10:78035902-78035924 ACATTTGAGCTGAGTTCAGAAGG + Intronic
1070724455 10:78778722-78778744 ACCCGGGATCAGAGGACAGAGGG + Intergenic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1072431064 10:95370787-95370809 AAATGCACTCAGAGGTCAGATGG - Intronic
1073094268 10:100970163-100970185 AAAGGTGATCAGAGTTCAGGGGG + Intronic
1073724678 10:106216199-106216221 ACAGGAGATGGGAGGTCAGAAGG + Intergenic
1074207114 10:111292586-111292608 ACCTGTGCTCAGAGGACACAGGG + Intergenic
1075153424 10:119955355-119955377 ACATTTGAGCAGAGACCAGAGGG + Intergenic
1075692928 10:124412042-124412064 AAATGTCATCAGAGGTTGGAGGG + Exonic
1076942798 10:133621038-133621060 TCTTGTGATCATTGGTCAGAAGG - Intergenic
1077921498 11:6645225-6645247 ACATGGAATAACAGGTCAGAGGG + Intronic
1078650471 11:13186195-13186217 ACATGAAATCAGAGGCCAGGAGG - Intergenic
1078651131 11:13193944-13193966 AGTTGTTATCATAGGTCAGAAGG + Intergenic
1079247765 11:18765611-18765633 CCAAGTGATAACAGGTCAGAAGG + Intronic
1081436037 11:43028336-43028358 ACAGGAGATCAGAGGCCAGCAGG + Intergenic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1085000174 11:73026618-73026640 ACATATGATTAAAGATCAGAAGG + Intronic
1085722220 11:78922681-78922703 ACATGTGATTATAGTTCAGCAGG + Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088831753 11:113542592-113542614 ACATTTGAACAGAGCTCTGAGGG - Intergenic
1096504364 12:52083180-52083202 TCATGTCCTCAGAGGCCAGAAGG - Intergenic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096660648 12:53122136-53122158 ATATGGGATCTGAGGTCAGAAGG - Intronic
1097545380 12:60993718-60993740 ACAAGAAATCAGAAGTCAGAGGG + Intergenic
1098620159 12:72586587-72586609 AAATGTGATCTGAGTTCACAGGG - Intronic
1098782463 12:74704093-74704115 AAATGGGATAATAGGTCAGAAGG + Intergenic
1101937919 12:109073692-109073714 GCATGTCATTTGAGGTCAGATGG + Intronic
1102382164 12:112476133-112476155 ACATCTGCTCAGGGGTCAGGTGG + Intronic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1104644989 12:130490881-130490903 AGATGTGGTCAGAGTTCAGTGGG + Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105073703 12:133255589-133255611 ACATGTGTTCATTGGTTAGAGGG + Intergenic
1105789903 13:23788369-23788391 ACATGTCATCACAGGTCAGTGGG + Intronic
1106051846 13:26197851-26197873 CCATATGATCAGAGAACAGACGG - Intronic
1106748546 13:32731403-32731425 ACATGTGAGCAGAGTTCTGAGGG - Intronic
1107000880 13:35543790-35543812 ACATGTGGTGAGAGGTGGGAAGG + Intronic
1107599514 13:41999062-41999084 TTATCTGATCAGACGTCAGATGG + Intergenic
1109023395 13:57129244-57129266 ACATGTGCACAGAGATCACATGG - Intergenic
1110516741 13:76421716-76421738 ACATTTGATCAGAGGCCATATGG - Intergenic
1110925350 13:81143674-81143696 CTATGTGATCAGATGTCTGAGGG + Intergenic
1111363739 13:87212060-87212082 CCATGTTATCAGAGGTAAAAAGG + Intergenic
1112485996 13:99820173-99820195 GCATGAGCTCAGAGGTCAAAGGG + Intronic
1112870131 13:103961409-103961431 AGATGTGAACAGAGCTGAGATGG - Intergenic
1113006505 13:105708842-105708864 TCATCTGATCAGATGTCAAAAGG + Intergenic
1113383100 13:109821374-109821396 ACATGTGATCAGAGCCTTGAAGG - Intergenic
1115820806 14:37210730-37210752 TCATGTGGCCAGAGGTCACAAGG - Intronic
1117180057 14:53182370-53182392 TCATGTGGCCAGAGGTCACAAGG + Intergenic
1118400122 14:65372190-65372212 ACAAGGCATCAGAGGTCAAAGGG - Intergenic
1118630409 14:67697317-67697339 ACATTTGAGCGGAGGCCAGAGGG + Intergenic
1119034154 14:71215708-71215730 ACATGTGACCAAAGCTCAAATGG + Intergenic
1119193170 14:72698064-72698086 ACATTTGAACTGAGATCAGAGGG - Intronic
1119355569 14:74003609-74003631 AGAGGTGATCAGCGATCAGAGGG - Intronic
1120431437 14:84421015-84421037 AGATGTGATCTGTAGTCAGATGG - Intergenic
1121732684 14:96197527-96197549 ACAAGTGATCAGAGGACAGGAGG + Intergenic
1122131384 14:99605915-99605937 AGCTGAGGTCAGAGGTCAGAGGG + Intergenic
1122349858 14:101082836-101082858 ACTTATGAGCAGAGGACAGAGGG + Intergenic
1122563398 14:102633295-102633317 ATATGTGATCTGGGGTCAGATGG + Intronic
1127042029 15:54987835-54987857 TCATGTGGCCAGAGGTCACAAGG - Intergenic
1127923623 15:63516288-63516310 AAATGACAGCAGAGGTCAGAGGG - Intronic
1128512489 15:68322011-68322033 ACAGGGGATCAGAGTTCTGAAGG + Intronic
1130152580 15:81322787-81322809 ACAAGTGATCACAGGTTATAGGG + Intronic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1130765260 15:86863790-86863812 ACATGGGTTCTGAAGTCAGATGG + Intronic
1132128608 15:99252735-99252757 ACATGTCATCAGATATTAGAAGG + Intronic
1134077221 16:11300309-11300331 ACATGTGCTGAGAGGCCGGAGGG + Intronic
1134204325 16:12224559-12224581 ACATTTGATCAGAGGGTTGAAGG + Intronic
1134471193 16:14527552-14527574 ACATGTGATCAGAGGTTTGTAGG - Intronic
1134691908 16:16196631-16196653 ACAACTGATAAGTGGTCAGAAGG + Intronic
1134804700 16:17114336-17114358 ACTTGTGATTAGCGGGCAGAAGG + Intronic
1135218798 16:20595241-20595263 ACATGTGCTCAGAGAACAGTTGG + Intergenic
1135933913 16:26762814-26762836 ACATGAGCCCAGAGGACAGAGGG + Intergenic
1136143136 16:28299857-28299879 AGATGAGAGCAGAGGTGAGAAGG - Intronic
1136710351 16:32231871-32231893 TCATGTGATCACAGGACAGGGGG + Intergenic
1138135486 16:54517653-54517675 ACATGTAAGCAGAGGCCTGAAGG - Intergenic
1138369770 16:56517479-56517501 ACATTTGATAAGAGGTTTGAAGG - Intronic
1140988890 16:80188806-80188828 ACATCTGAGCAGAGGCCTGAAGG - Intergenic
1142249703 16:88985734-88985756 ACATGTGCTCCGAGCTCAGGTGG - Intergenic
1203059709 16_KI270728v1_random:957889-957911 TCATGTGATCACAGGACAGGGGG - Intergenic
1203139593 16_KI270728v1_random:1752525-1752547 ACATGTACTCTGAAGTCAGATGG + Intergenic
1144022632 17:11250745-11250767 ACACGTGAGCAGAGTTAAGAGGG - Intronic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1146588333 17:34102510-34102532 AAATGTAATCTGAGGTGAGAAGG - Intronic
1146599961 17:34205615-34205637 AGAAGTGTTCAGAGGTGAGAGGG - Intergenic
1146671427 17:34740721-34740743 ACATTAAATCAGAGCTCAGAGGG - Intergenic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150952542 17:69819950-69819972 ACATGTGCTCAAAGGTTAGTAGG - Intergenic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1158580458 18:58676461-58676483 ACATGTGACCAGAGTAGAGAGGG - Intronic
1160225889 18:77010124-77010146 AGAGGTGATGGGAGGTCAGAGGG + Intronic
1161422333 19:4182696-4182718 ACATGTTATCTGCTGTCAGAAGG + Intergenic
1162214837 19:9125556-9125578 ACATGAGACCAGAGATCAGATGG - Intergenic
1162244890 19:9391585-9391607 ACATGTGATCTTTGATCAGAAGG - Intergenic
1162400645 19:10444570-10444592 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1162558929 19:11404645-11404667 ACATTTAATCAGAGACCAGAAGG + Intronic
1163006040 19:14397255-14397277 ACATGTGATCAGATGTTTGTGGG - Intronic
1163061704 19:14766181-14766203 ACATGTGATCAGATGTTTGTGGG + Intronic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1165335783 19:35168749-35168771 ACATTTGAACAAAGGTCTGAAGG - Intronic
1165934726 19:39382480-39382502 ACATGAGCTCAGGGTTCAGAGGG + Intronic
1166481795 19:43180456-43180478 ACATCACATCAGTGGTCAGAAGG + Intronic
1166614825 19:44233981-44234003 ACATGTGAGCAGAGACCTGAAGG + Intronic
1167018053 19:46854593-46854615 ACATTTGAGCTGAGATCAGAAGG + Intergenic
1167232909 19:48296742-48296764 ACAGGAGATCAGGAGTCAGAGGG + Exonic
1167927719 19:52834979-52835001 TCATGTGATCACAGGACAGGGGG + Intronic
1168073543 19:53965857-53965879 ACATTTGATCACAGGTCTGAAGG + Intronic
927672893 2:25083765-25083787 ATTTGGGCTCAGAGGTCAGATGG - Intronic
927845473 2:26470125-26470147 ACATGTTCTCAGAGGCCATAAGG - Intronic
929015631 2:37491521-37491543 AGATGTCATCAGAAGTCAGTGGG - Intergenic
929695940 2:44115274-44115296 AAATATGATCAGAGGACAGAAGG - Intergenic
930358641 2:50350105-50350127 AAATGTGATCAGAGGTTTGCAGG - Intronic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
933055935 2:77665151-77665173 ATTTGTGTTCAGAGGTCTGATGG - Intergenic
933099497 2:78234769-78234791 ACATGTGGGAAGAGGACAGAAGG + Intergenic
933730504 2:85452608-85452630 ACATCTGAGCAGAGACCAGAAGG - Intergenic
934631014 2:95922098-95922120 AAATGTGATCAAAAATCAGAGGG + Intronic
934803034 2:97186884-97186906 AAATGTGATCAAAAATCAGAGGG - Intronic
934987668 2:98899596-98899618 AGATGTGCTCAGCAGTCAGAGGG + Intronic
935974105 2:108560383-108560405 AGATGAGATCAGAGGGCAGCAGG - Intronic
936052067 2:109231618-109231640 ACATGTCATCTGAGAGCAGAGGG - Intronic
937093688 2:119223011-119223033 AAATGTGACCACAGGTGAGAAGG + Intergenic
939597438 2:144143773-144143795 ACATGTGTTCATAAGTCAGAGGG + Intronic
941561677 2:167054372-167054394 TCATGTGTTCTGAGGTCAAAAGG + Intronic
941982384 2:171472973-171472995 ACATGTGATAACATATCAGATGG + Intronic
942985747 2:182139376-182139398 ACATTTAAACAGAGGACAGAAGG + Intergenic
943862061 2:192879113-192879135 TCATTTAATCAGATGTCAGATGG - Intergenic
945372860 2:209041868-209041890 AAATGTGACCAGAGGTTTGAAGG + Intergenic
946285087 2:218696844-218696866 ACATGAGTTGTGAGGTCAGAGGG + Intronic
1169300215 20:4435802-4435824 ACATGGCATCTGAGGTCTGAAGG - Intergenic
1172069555 20:32246557-32246579 ACATTTGAGCAGAGGCCTGAAGG + Intergenic
1172430657 20:34888736-34888758 ACATTTGAGCAGAGATCTGAAGG + Intronic
1172435245 20:34924436-34924458 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1172694649 20:36814013-36814035 TGATCTGACCAGAGGTCAGAGGG - Intronic
1173423638 20:42924769-42924791 AGATTTGATCACAGGTCAGCTGG + Intronic
1173677054 20:44845030-44845052 ACATTTGAGAAGAGGTCTGAAGG - Intergenic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174177013 20:48651603-48651625 ACATCTGAGCAGAGATCAGAGGG + Intronic
1174180734 20:48672721-48672743 ACATTTGAGCAGAGGGCTGAGGG - Intronic
1174836735 20:53862923-53862945 ACATGTACTCCGATGTCAGATGG + Intergenic
1175807988 20:61841361-61841383 ACAAGTCATCAGAGGTGACAGGG + Intronic
1179337056 21:40466669-40466691 AGCTGTCTTCAGAGGTCAGAAGG - Intronic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1183551691 22:38491093-38491115 ACATGACCTCAGAGGGCAGAGGG + Intronic
1183792525 22:40084499-40084521 AGATGTGCTCAAATGTCAGACGG + Intronic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184981520 22:48099159-48099181 AGGTGTGATCAGAGGACAGCGGG + Intergenic
949856438 3:8466160-8466182 ACATGGGATTTGAGTTCAGATGG - Intergenic
954682288 3:52352209-52352231 ACATGTGATGGGCGGGCAGATGG + Intronic
955614083 3:60787326-60787348 ACATTTGAGCAGTGCTCAGAAGG - Intronic
956441724 3:69287328-69287350 ACATGTGTGCAGGGATCAGAAGG + Intronic
956674512 3:71721845-71721867 ACATGTGAGCAGAGGCTTGAAGG + Intronic
956836315 3:73099111-73099133 ACATGTGAGCAGAGATTGGAAGG + Intergenic
960994817 3:123333695-123333717 AGGTGTGCTCAGAGGTCAAACGG - Intronic
961867702 3:129965795-129965817 ACATGTGTTCACAGAACAGAGGG - Intergenic
964726209 3:159816719-159816741 AAATGAGACCAGAGGTCAGCAGG - Intronic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
969148001 4:5141289-5141311 ACATGTGAGCAGAGACCTGAAGG + Intronic
969554967 4:7901309-7901331 ACCTGTGATTTGATGTCAGAAGG - Intronic
970904864 4:21203795-21203817 ACAAGTGATATGAGGTTAGAGGG + Intronic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
973261220 4:48165964-48165986 GCATGGGAACACAGGTCAGAGGG - Intronic
974506556 4:62781569-62781591 AAATGTGATCAGAAGTATGAGGG + Intergenic
975619752 4:76284378-76284400 ACATAAGGTCATAGGTCAGAAGG + Intronic
976254456 4:83085436-83085458 TCATGTGATCATAGGACAGGGGG - Intergenic
977456663 4:97270339-97270361 ACATGTTATCTGAGTTCACATGG - Intronic
981321261 4:143394529-143394551 ACATGTGATCAGTTTTCTGAGGG - Intronic
981505754 4:145497703-145497725 ACAAGTGATCAGAGGTAGAAAGG + Intronic
982800631 4:159702325-159702347 CCCTGTGCTCAGAGGTCAAATGG + Intergenic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
986367170 5:7043921-7043943 AGATGCGATCAGAGGTCATATGG - Intergenic
988181731 5:27803675-27803697 ACATGTGATAAGAGCTAAGAAGG - Intergenic
989137237 5:38167528-38167550 ACATGTCCTCAGAGCTCTGAAGG - Intergenic
990113985 5:52366196-52366218 ACCTGTGGTCAGAGGGCACAGGG + Intergenic
990887167 5:60607729-60607751 ACATGTGAGCAGAGATCCAAAGG + Intronic
990935233 5:61140801-61140823 GCATGTGATCAGAGGTATGAAGG - Intronic
992337920 5:75792503-75792525 ATATGTGAGTAGAGGTCTGATGG + Intergenic
992688945 5:79224530-79224552 TCATGTGGCCAGAGGTCACAAGG - Intronic
993426092 5:87765870-87765892 AAATATAATCAGAGGTCAGAAGG + Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
993586719 5:89740016-89740038 AAATATGTTCAGAGGTCTGATGG + Intergenic
998722659 5:144972430-144972452 ACTTGTGAACAGAGGACAGCAGG + Intergenic
999272456 5:150304557-150304579 ACAAGTCACCAGAGGTCAGGTGG + Intronic
1000407982 5:160908853-160908875 AGATTTGATGAGAGGACAGAAGG - Intergenic
1000722148 5:164721402-164721424 ACATTTAAACAGAGGTTAGATGG - Intergenic
1000901522 5:166917049-166917071 ACATGTGAGCAGAGACCTGAAGG - Intergenic
1002341705 5:178520595-178520617 ACATGTGTTCAGAAGTGAGGTGG + Intronic
1003712285 6:8605416-8605438 ACAGGGCATCAGAGGGCAGAGGG - Intergenic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006837760 6:37009177-37009199 TGGTGTGATCAGAGGTCAGCTGG + Intronic
1007227650 6:40326147-40326169 ACATGACATCAGTGGACAGAAGG + Intergenic
1008008291 6:46436053-46436075 ATATGTGCTCAGATTTCAGAAGG + Intronic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1008539196 6:52531874-52531896 TCATGACATCAGAGATCAGATGG + Intronic
1010049134 6:71482781-71482803 AAATGTGAGCAGAGGTGAGATGG - Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1013661385 6:112300246-112300268 ACCTGTGATCATCTGTCAGAGGG + Intergenic
1013792053 6:113848464-113848486 AGATGAGATCAGAGATAAGAAGG - Intergenic
1014924220 6:127252413-127252435 ACATGATAGCAGAGGTCAAATGG + Intergenic
1016770257 6:147841644-147841666 AAATGTGATTACTGGTCAGAGGG - Intergenic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017710004 6:157158980-157159002 ACATCTTCTCAGAGGTCAGTGGG + Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019451253 7:1099736-1099758 ACATCTGTGCACAGGTCAGACGG - Intronic
1021327210 7:19287990-19288012 ATATGTGAGCAGTGGTCAGCTGG - Intergenic
1022254518 7:28642792-28642814 GCATGCGATCAGAGTACAGATGG + Intronic
1022261626 7:28711065-28711087 AGAGGTGGTCAGAGGCCAGATGG + Intronic
1022619825 7:31971713-31971735 ACAAGAGATCAGAGCTCAGGAGG + Intronic
1025082958 7:56000424-56000446 ACACGAGCTCAGAGGTCACAGGG + Intergenic
1026107318 7:67431504-67431526 ACATGTGAGCTGGGGTCATAGGG - Intergenic
1026820204 7:73542281-73542303 ACGTGTGTTCAGTAGTCAGAAGG - Intronic
1027862054 7:83596754-83596776 TCATGAGATCAGAGATCACAGGG - Intronic
1031303765 7:120098122-120098144 ACATGTTATAGGATGTCAGAAGG - Intergenic
1032026769 7:128449106-128449128 ACATTTGATCAGGGTCCAGAAGG + Intergenic
1032508306 7:132452400-132452422 ACATGTTAGCAGAGCTCAGAAGG + Intronic
1032543626 7:132724483-132724505 ATGTGTGAGCAGAGGTCAGCAGG - Intronic
1034268442 7:149792139-149792161 AGATGTCATCACAGGTCAGTGGG - Intergenic
1035494281 7:159309016-159309038 ACATGTGTTCGTTGGTCAGAGGG + Intergenic
1041650225 8:60294933-60294955 TCATGTGATCATAGGACAGGGGG - Intergenic
1042079969 8:65040778-65040800 ACATTTGATCTGAGATCTGAAGG - Intergenic
1042933899 8:74039626-74039648 TCATGTGATCATAGGACAGGGGG + Intergenic
1043293264 8:78630923-78630945 ACATGTGCTCTGAAGTAAGAAGG + Intergenic
1047026289 8:120828064-120828086 AGTTGTTCTCAGAGGTCAGATGG + Intergenic
1048228532 8:132614227-132614249 ACATCTGAGCAGAGGCCTGAAGG + Intronic
1048864303 8:138748226-138748248 ACAGATGTTCAGAGGACAGAGGG - Intronic
1049505058 8:142991733-142991755 ACCTGAGACCAGAGGTCAGCAGG + Intergenic
1050376913 9:4984031-4984053 ACATTTGAGCAGAGATCTGAAGG - Intergenic
1051115755 9:13692582-13692604 ACATGTGACCAGTGATCATATGG - Intergenic
1052206305 9:25845211-25845233 GCATGTGATCAGCTTTCAGATGG + Intergenic
1057450267 9:95152367-95152389 ATATGTGAGCAGAGCTCTGAAGG + Intronic
1057495300 9:95555618-95555640 GCATGTGAGCAGAGGTCTGCAGG - Intergenic
1058260450 9:102823051-102823073 ACATGGACTCAGAGGTCAGAGGG - Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1059854894 9:118385609-118385631 ACATTTGATGTAAGGTCAGAAGG - Intergenic
1186578414 X:10790852-10790874 AAATATGATAAGAGCTCAGAGGG - Intronic
1187328197 X:18311508-18311530 ACATGTGAGCAGAAATCTGAAGG + Intronic
1187609931 X:20931564-20931586 ACATGTGATCAGAGTCCAAGAGG - Intergenic
1188559865 X:31455286-31455308 AATTGTGATCAGGGTTCAGAAGG - Intronic
1189036298 X:37496479-37496501 TCATGTAGTCAGAGGTCACAAGG - Intronic
1189319925 X:40081801-40081823 ACAGCTGAGAAGAGGTCAGATGG + Intronic
1189987640 X:46568442-46568464 ACATGTTATTAGTGGTCTGAAGG - Intergenic
1190176610 X:48155815-48155837 AAATGTAATCAGAGGTTGGAGGG + Intergenic
1190222313 X:48520400-48520422 ACAAGTGGTCAGAGCTCAGCTGG + Exonic
1190661135 X:52655311-52655333 AAATGTAATCAGAGGTTGGAGGG - Intronic
1192240140 X:69322053-69322075 ACAGGCGATCAGAGCTCAGAGGG - Intergenic
1192248955 X:69395285-69395307 ACAAGTGATTAGAGGTAAGCTGG - Intergenic
1194050265 X:89059467-89059489 AAGTGTGATCAGAGGACAAAAGG + Intergenic
1200884875 Y:8257562-8257584 ACATGTGTTCAGAGATCAAGGGG + Intergenic
1200972341 Y:9166428-9166450 ACATTTGGACAGAGTTCAGATGG - Intergenic
1202138681 Y:21697854-21697876 ACATTTGGACAGAGTTCAGATGG + Intergenic