ID: 1163755901

View in Genome Browser
Species Human (GRCh38)
Location 19:19106013-19106035
Sequence GCGTATTTTCCCTACGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755901_1163755909 8 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755909 19:19106044-19106066 TTTATGCCAGCAGGGGGGAAGGG 0: 1
1: 0
2: 2
3: 16
4: 142
1163755901_1163755910 12 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755910 19:19106048-19106070 TGCCAGCAGGGGGGAAGGGAAGG 0: 1
1: 0
2: 4
3: 78
4: 763
1163755901_1163755907 3 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755907 19:19106039-19106061 ATTAATTTATGCCAGCAGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1163755901_1163755908 7 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755908 19:19106043-19106065 ATTTATGCCAGCAGGGGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 158
1163755901_1163755903 -1 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755903 19:19106035-19106057 CATCATTAATTTATGCCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1163755901_1163755904 0 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755904 19:19106036-19106058 ATCATTAATTTATGCCAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 252
1163755901_1163755905 1 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755905 19:19106037-19106059 TCATTAATTTATGCCAGCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 152
1163755901_1163755906 2 Left 1163755901 19:19106013-19106035 CCAGGGCCGTAGGGAAAATACGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1163755906 19:19106038-19106060 CATTAATTTATGCCAGCAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755901 Original CRISPR GCGTATTTTCCCTACGGCCC TGG (reversed) Intronic
902043543 1:13509479-13509501 GCATATTCTCCCTATGGCCCAGG + Intronic
907002256 1:50873351-50873373 GCCTTTTTCCCCTATGGCCCTGG + Intronic
922223640 1:223627275-223627297 GCCTATTTTGCCTATGGGCCAGG + Intronic
1076201284 10:128560693-128560715 GTTTATTTTCCCTAAGCCCCTGG + Intergenic
1088584049 11:111344390-111344412 GCATCTTTTCCCCAAGGCCCTGG + Intergenic
1124901168 15:33823957-33823979 ACGTATGCTCCCTACTGCCCAGG - Intronic
1137756565 16:50906788-50906810 GCGTCTTTGCCCTACAGCCATGG - Intergenic
1151128338 17:71869396-71869418 GAGTGTTTTCCCAACAGCCCTGG - Intergenic
1163755901 19:19106013-19106035 GCGTATTTTCCCTACGGCCCTGG - Intronic
1166904913 19:46101394-46101416 GAATCTTTTCCCTAAGGCCCTGG + Intergenic
1173809707 20:45948409-45948431 GCGTGTGCTCCCTAGGGCCCAGG + Intergenic
1176249283 20:64112576-64112598 GCGACTGTTCCCTAGGGCCCAGG + Intergenic
1179985061 21:44915844-44915866 GCGTATTTTCCCAAGGGTCAGGG + Intronic
967949221 3:194827954-194827976 CCGTATTTTCCCTACAGAGCTGG - Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
1005140502 6:22626376-22626398 GCGTATTTTACGTGTGGCCCAGG + Intergenic
1019661166 7:2224801-2224823 GGGTGTTTTCCCTGCTGCCCTGG + Intronic
1037838280 8:22227371-22227393 GCATATTTTCCCTTCCTCCCTGG - Intronic
1053338357 9:37299231-37299253 GAGGACTTTCCATACGGCCCAGG - Intronic
1055936941 9:81612441-81612463 GCCTATTTTCCTTTGGGCCCAGG + Intronic
1188535787 X:31195320-31195342 GCATATGTTCCCTAGGGCCATGG - Intronic
1199704324 X:150411020-150411042 GTGTATTTTATGTACGGCCCAGG + Intronic