ID: 1163755928

View in Genome Browser
Species Human (GRCh38)
Location 19:19106140-19106162
Sequence GGGGACCGAGGAACACGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755928_1163755941 10 Left 1163755928 19:19106140-19106162 CCGCCTCGTGTTCCTCGGTCCCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1163755941 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1163755928_1163755947 24 Left 1163755928 19:19106140-19106162 CCGCCTCGTGTTCCTCGGTCCCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755928_1163755939 9 Left 1163755928 19:19106140-19106162 CCGCCTCGTGTTCCTCGGTCCCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1163755939 19:19106172-19106194 CCCGCCCCAGCAGAGACGTGCGG 0: 1
1: 0
2: 1
3: 17
4: 474
1163755928_1163755945 19 Left 1163755928 19:19106140-19106162 CCGCCTCGTGTTCCTCGGTCCCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1163755945 19:19106182-19106204 CAGAGACGTGCGGGTGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 105
1163755928_1163755946 23 Left 1163755928 19:19106140-19106162 CCGCCTCGTGTTCCTCGGTCCCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755928 Original CRISPR GGGGACCGAGGAACACGAGG CGG (reversed) Intronic