ID: 1163755930

View in Genome Browser
Species Human (GRCh38)
Location 19:19106152-19106174
Sequence GGGGACAGGGGTGGGGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2516
Summary {0: 1, 1: 2, 2: 12, 3: 142, 4: 2359}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755930_1163755941 -2 Left 1163755930 19:19106152-19106174 CCTCGGTCCCCACCCCTGTCCCC 0: 1
1: 2
2: 12
3: 142
4: 2359
Right 1163755941 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1163755930_1163755947 12 Left 1163755930 19:19106152-19106174 CCTCGGTCCCCACCCCTGTCCCC 0: 1
1: 2
2: 12
3: 142
4: 2359
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755930_1163755945 7 Left 1163755930 19:19106152-19106174 CCTCGGTCCCCACCCCTGTCCCC 0: 1
1: 2
2: 12
3: 142
4: 2359
Right 1163755945 19:19106182-19106204 CAGAGACGTGCGGGTGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 105
1163755930_1163755939 -3 Left 1163755930 19:19106152-19106174 CCTCGGTCCCCACCCCTGTCCCC 0: 1
1: 2
2: 12
3: 142
4: 2359
Right 1163755939 19:19106172-19106194 CCCGCCCCAGCAGAGACGTGCGG 0: 1
1: 0
2: 1
3: 17
4: 474
1163755930_1163755946 11 Left 1163755930 19:19106152-19106174 CCTCGGTCCCCACCCCTGTCCCC 0: 1
1: 2
2: 12
3: 142
4: 2359
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755930 Original CRISPR GGGGACAGGGGTGGGGACCG AGG (reversed) Intronic