ID: 1163755931

View in Genome Browser
Species Human (GRCh38)
Location 19:19106159-19106181
Sequence CTGGGGCGGGGACAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2645
Summary {0: 1, 1: 3, 2: 21, 3: 262, 4: 2358}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755931_1163755946 4 Left 1163755931 19:19106159-19106181 CCCCACCCCTGTCCCCGCCCCAG 0: 1
1: 3
2: 21
3: 262
4: 2358
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108
1163755931_1163755939 -10 Left 1163755931 19:19106159-19106181 CCCCACCCCTGTCCCCGCCCCAG 0: 1
1: 3
2: 21
3: 262
4: 2358
Right 1163755939 19:19106172-19106194 CCCGCCCCAGCAGAGACGTGCGG 0: 1
1: 0
2: 1
3: 17
4: 474
1163755931_1163755945 0 Left 1163755931 19:19106159-19106181 CCCCACCCCTGTCCCCGCCCCAG 0: 1
1: 3
2: 21
3: 262
4: 2358
Right 1163755945 19:19106182-19106204 CAGAGACGTGCGGGTGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 105
1163755931_1163755941 -9 Left 1163755931 19:19106159-19106181 CCCCACCCCTGTCCCCGCCCCAG 0: 1
1: 3
2: 21
3: 262
4: 2358
Right 1163755941 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1163755931_1163755947 5 Left 1163755931 19:19106159-19106181 CCCCACCCCTGTCCCCGCCCCAG 0: 1
1: 3
2: 21
3: 262
4: 2358
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755931 Original CRISPR CTGGGGCGGGGACAGGGGTG GGG (reversed) Intronic