ID: 1163755932

View in Genome Browser
Species Human (GRCh38)
Location 19:19106160-19106182
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2274
Summary {0: 1, 1: 0, 2: 27, 3: 235, 4: 2011}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755932_1163755945 -1 Left 1163755932 19:19106160-19106182 CCCACCCCTGTCCCCGCCCCAGC 0: 1
1: 0
2: 27
3: 235
4: 2011
Right 1163755945 19:19106182-19106204 CAGAGACGTGCGGGTGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 105
1163755932_1163755947 4 Left 1163755932 19:19106160-19106182 CCCACCCCTGTCCCCGCCCCAGC 0: 1
1: 0
2: 27
3: 235
4: 2011
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755932_1163755941 -10 Left 1163755932 19:19106160-19106182 CCCACCCCTGTCCCCGCCCCAGC 0: 1
1: 0
2: 27
3: 235
4: 2011
Right 1163755941 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1163755932_1163755946 3 Left 1163755932 19:19106160-19106182 CCCACCCCTGTCCCCGCCCCAGC 0: 1
1: 0
2: 27
3: 235
4: 2011
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755932 Original CRISPR GCTGGGGCGGGGACAGGGGT GGG (reversed) Intronic