ID: 1163755933

View in Genome Browser
Species Human (GRCh38)
Location 19:19106161-19106183
Sequence TGCTGGGGCGGGGACAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1652
Summary {0: 1, 1: 1, 2: 17, 3: 177, 4: 1456}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755933_1163755947 3 Left 1163755933 19:19106161-19106183 CCACCCCTGTCCCCGCCCCAGCA 0: 1
1: 1
2: 17
3: 177
4: 1456
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755933_1163755946 2 Left 1163755933 19:19106161-19106183 CCACCCCTGTCCCCGCCCCAGCA 0: 1
1: 1
2: 17
3: 177
4: 1456
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108
1163755933_1163755945 -2 Left 1163755933 19:19106161-19106183 CCACCCCTGTCCCCGCCCCAGCA 0: 1
1: 1
2: 17
3: 177
4: 1456
Right 1163755945 19:19106182-19106204 CAGAGACGTGCGGGTGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755933 Original CRISPR TGCTGGGGCGGGGACAGGGG TGG (reversed) Intronic