ID: 1163755936

View in Genome Browser
Species Human (GRCh38)
Location 19:19106166-19106188
Sequence GTCTCTGCTGGGGCGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 1, 2: 0, 3: 39, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755936_1163755945 -7 Left 1163755936 19:19106166-19106188 CCTGTCCCCGCCCCAGCAGAGAC 0: 1
1: 1
2: 0
3: 39
4: 413
Right 1163755945 19:19106182-19106204 CAGAGACGTGCGGGTGCTCCAGG 0: 1
1: 0
2: 1
3: 3
4: 105
1163755936_1163755946 -3 Left 1163755936 19:19106166-19106188 CCTGTCCCCGCCCCAGCAGAGAC 0: 1
1: 1
2: 0
3: 39
4: 413
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108
1163755936_1163755947 -2 Left 1163755936 19:19106166-19106188 CCTGTCCCCGCCCCAGCAGAGAC 0: 1
1: 1
2: 0
3: 39
4: 413
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755936 Original CRISPR GTCTCTGCTGGGGCGGGGAC AGG (reversed) Intronic