ID: 1163755938

View in Genome Browser
Species Human (GRCh38)
Location 19:19106172-19106194
Sequence CCGCACGTCTCTGCTGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755938_1163755946 -9 Left 1163755938 19:19106172-19106194 CCCGCCCCAGCAGAGACGTGCGG 0: 1
1: 0
2: 3
3: 15
4: 133
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108
1163755938_1163755947 -8 Left 1163755938 19:19106172-19106194 CCCGCCCCAGCAGAGACGTGCGG 0: 1
1: 0
2: 3
3: 15
4: 133
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755938 Original CRISPR CCGCACGTCTCTGCTGGGGC GGG (reversed) Intronic