ID: 1163755940

View in Genome Browser
Species Human (GRCh38)
Location 19:19106173-19106195
Sequence CCCGCACGTCTCTGCTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755940_1163755947 -9 Left 1163755940 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755940_1163755946 -10 Left 1163755940 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1163755946 19:19106186-19106208 GACGTGCGGGTGCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755940 Original CRISPR CCCGCACGTCTCTGCTGGGG CGG (reversed) Intronic