ID: 1163755947

View in Genome Browser
Species Human (GRCh38)
Location 19:19106187-19106209
Sequence ACGTGCGGGTGCTCCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 100}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163755936_1163755947 -2 Left 1163755936 19:19106166-19106188 CCTGTCCCCGCCCCAGCAGAGAC 0: 1
1: 1
2: 0
3: 39
4: 413
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755925_1163755947 30 Left 1163755925 19:19106134-19106156 CCAAACCCGCCTCGTGTTCCTCG 0: 1
1: 0
2: 1
3: 2
4: 50
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755932_1163755947 4 Left 1163755932 19:19106160-19106182 CCCACCCCTGTCCCCGCCCCAGC 0: 1
1: 0
2: 27
3: 235
4: 2011
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755933_1163755947 3 Left 1163755933 19:19106161-19106183 CCACCCCTGTCCCCGCCCCAGCA 0: 1
1: 1
2: 17
3: 177
4: 1456
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755927_1163755947 25 Left 1163755927 19:19106139-19106161 CCCGCCTCGTGTTCCTCGGTCCC 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755938_1163755947 -8 Left 1163755938 19:19106172-19106194 CCCGCCCCAGCAGAGACGTGCGG 0: 1
1: 0
2: 3
3: 15
4: 133
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755930_1163755947 12 Left 1163755930 19:19106152-19106174 CCTCGGTCCCCACCCCTGTCCCC 0: 1
1: 2
2: 12
3: 142
4: 2359
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755940_1163755947 -9 Left 1163755940 19:19106173-19106195 CCGCCCCAGCAGAGACGTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755934_1163755947 0 Left 1163755934 19:19106164-19106186 CCCCTGTCCCCGCCCCAGCAGAG 0: 1
1: 0
2: 5
3: 54
4: 593
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755935_1163755947 -1 Left 1163755935 19:19106165-19106187 CCCTGTCCCCGCCCCAGCAGAGA 0: 1
1: 0
2: 3
3: 29
4: 361
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755929_1163755947 21 Left 1163755929 19:19106143-19106165 CCTCGTGTTCCTCGGTCCCCACC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755928_1163755947 24 Left 1163755928 19:19106140-19106162 CCGCCTCGTGTTCCTCGGTCCCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755937_1163755947 -7 Left 1163755937 19:19106171-19106193 CCCCGCCCCAGCAGAGACGTGCG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1163755931_1163755947 5 Left 1163755931 19:19106159-19106181 CCCCACCCCTGTCCCCGCCCCAG 0: 1
1: 3
2: 21
3: 262
4: 2358
Right 1163755947 19:19106187-19106209 ACGTGCGGGTGCTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163755947 Original CRISPR ACGTGCGGGTGCTCCAGGCT GGG Intronic