ID: 1163757558

View in Genome Browser
Species Human (GRCh38)
Location 19:19115463-19115485
Sequence AAATCTGGGCTGGATGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163757558_1163757563 19 Left 1163757558 19:19115463-19115485 CCTCTGACATCCAGCCCAGATTT No data
Right 1163757563 19:19115505-19115527 TCACACCAGCCCCTGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163757558 Original CRISPR AAATCTGGGCTGGATGTCAG AGG (reversed) Intergenic