ID: 1163760250

View in Genome Browser
Species Human (GRCh38)
Location 19:19132602-19132624
Sequence GTGGAGACCTTCAGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 227}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163760243_1163760250 -10 Left 1163760243 19:19132589-19132611 CCCCCATGAGGGTGTGGAGACCT 0: 1
1: 0
2: 2
3: 13
4: 108
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760233_1163760250 27 Left 1163760233 19:19132552-19132574 CCTCCTAATAGAACATTCTTCCT 0: 1
1: 0
2: 1
3: 10
4: 224
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760242_1163760250 -7 Left 1163760242 19:19132586-19132608 CCACCCCCATGAGGGTGTGGAGA 0: 1
1: 0
2: 2
3: 24
4: 176
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760234_1163760250 24 Left 1163760234 19:19132555-19132577 CCTAATAGAACATTCTTCCTTCA 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760240_1163760250 -5 Left 1163760240 19:19132584-19132606 CCCCACCCCCATGAGGGTGTGGA 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760241_1163760250 -6 Left 1163760241 19:19132585-19132607 CCCACCCCCATGAGGGTGTGGAG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760231_1163760250 29 Left 1163760231 19:19132550-19132572 CCCCTCCTAATAGAACATTCTTC 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760235_1163760250 7 Left 1163760235 19:19132572-19132594 CCTTCAAATCCTCCCCACCCCCA 0: 1
1: 0
2: 14
3: 82
4: 804
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760238_1163760250 -2 Left 1163760238 19:19132581-19132603 CCTCCCCACCCCCATGAGGGTGT 0: 1
1: 0
2: 3
3: 35
4: 346
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227
1163760232_1163760250 28 Left 1163760232 19:19132551-19132573 CCCTCCTAATAGAACATTCTTCC 0: 1
1: 0
2: 1
3: 27
4: 226
Right 1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163760250 Original CRISPR GTGGAGACCTTCAGGGCTGA GGG Intronic
900322657 1:2092819-2092841 GTGGACCCCTGCAGGGCTGGAGG + Intronic
900670948 1:3854435-3854457 TTGGAGGGCTTCAGAGCTGAAGG - Intronic
901204541 1:7486544-7486566 ATGGAGACTTCCAAGGCTGACGG + Intronic
901626839 1:10629550-10629572 GAGGGGATCTTCGGGGCTGATGG - Exonic
901731073 1:11280183-11280205 GCTGAGTCCTCCAGGGCTGAAGG + Intronic
902786081 1:18733597-18733619 GGGGAGACCCCCAGGGCTGAGGG + Intronic
903693184 1:25188705-25188727 GAGGAAACCTTTAGGGGTGATGG + Intergenic
905536460 1:38726221-38726243 GTAGAGTCCTTTAGGGCTGCAGG - Intergenic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
908097483 1:60754244-60754266 GTGAAGACCTACAGGCATGAAGG - Intergenic
909487750 1:76192513-76192535 GAGGAGACCTTTAAGGCTGTGGG - Intronic
912481299 1:109984169-109984191 GTGGAGACCAGGAGAGCTGATGG - Intergenic
912799630 1:112712806-112712828 GTGAAGACCAGCAGGACTGAGGG + Exonic
913325437 1:117624045-117624067 GTGGAAACCCTCAGGTCTCAAGG - Exonic
915063663 1:153207193-153207215 GAGGAGACCTTGAGGTCTCAGGG + Intergenic
918247854 1:182675624-182675646 GTGGGGACATTCCGGGCAGAAGG - Intronic
919919137 1:202157983-202158005 AAAGAGAACTTCAGGGCTGAGGG - Intronic
920089124 1:203440003-203440025 GTGGAGGCCTTCCTGGCAGAGGG + Intergenic
921414964 1:214875062-214875084 GTGCAGACATTCAGAGCTGGAGG - Intergenic
921609910 1:217199559-217199581 ATGGAGACTTTCCGGGTTGATGG - Intergenic
922368335 1:224886656-224886678 GTGGAGACCTAAAGAGCAGATGG - Intergenic
922984250 1:229853742-229853764 GAGGAGACCTTCAGTGTTGTGGG - Intergenic
923750456 1:236741928-236741950 GTGGAGTGCCTCAGGGCAGAGGG - Intronic
924716966 1:246584685-246584707 GTGGAGGACTGCAGGGCTGCCGG - Intronic
1064732908 10:18350637-18350659 GTGGACTCCTGGAGGGCTGATGG - Intronic
1068939926 10:62670714-62670736 GTGGAGCCCTTCAGAGATGTAGG - Exonic
1069140877 10:64823620-64823642 GCTGAGACCTTAAGGACTGAAGG - Intergenic
1070360018 10:75679057-75679079 GTGAAGACCTTCAGAGTTGGAGG + Intronic
1076411893 10:130257572-130257594 ATGGAGGCCTTTAGGGCAGATGG - Intergenic
1078183075 11:9028735-9028757 GGGCAGCCCTTCAGGACTGAAGG - Intronic
1078444851 11:11396411-11396433 ATGGAGAGCTGCAGGGATGATGG + Intronic
1079485373 11:20930996-20931018 GTTGAGAACTTCTGGGCTGGAGG + Intronic
1079612755 11:22453427-22453449 TTGCAGACTTTCAGAGCTGAAGG - Intergenic
1082783053 11:57301799-57301821 GATGGTACCTTCAGGGCTGAGGG + Exonic
1082893687 11:58167016-58167038 ATGGAGACCTGCAAGGGTGAGGG - Intronic
1083304238 11:61754438-61754460 TTTGAGACCTTCAGGGAAGAGGG + Intronic
1083720671 11:64602099-64602121 GTGGAGTCGGTCAGGGATGAGGG - Exonic
1084088996 11:66867998-66868020 GTAGAGACCTTGAAGGGTGAGGG + Intronic
1084534901 11:69750831-69750853 GCAGAGATCTTCAGGGCTGGGGG + Intergenic
1084640865 11:70424842-70424864 GTGGAGACTGTCAGGGCTCATGG - Intronic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085743252 11:79094626-79094648 GGGGAGACAGTCAGAGCTGAAGG - Intronic
1088194040 11:107256529-107256551 GTGGAGGCCTGCAGGGCTTTTGG - Intergenic
1088586755 11:111366604-111366626 AGTGAGATCTTCAGGGCTGATGG - Intronic
1089608555 11:119656517-119656539 GTGGGGGCTTTCAGGGATGAGGG + Intronic
1089637970 11:119828547-119828569 GTGGAGACATTCAGGATTGAGGG + Intergenic
1091335565 11:134763082-134763104 GTGGAGAGCTGCGGGGCCGAGGG - Intergenic
1091403781 12:196592-196614 CTGGAGACCCTCTGGGGTGAAGG - Intronic
1092701107 12:11231885-11231907 GTGGAGACCTGCATGGATAAAGG + Intergenic
1093733872 12:22596350-22596372 GTTGAAATCTTGAGGGCTGAAGG - Intergenic
1095062922 12:37723579-37723601 GTGGAGACCTTTTTGGCCGATGG + Intergenic
1096155546 12:49339509-49339531 GTGGTGACCAGCAGGGCTGCAGG + Intergenic
1096826630 12:54283542-54283564 GTGAAGGCCTTCAAGGCTGAAGG + Intronic
1097354499 12:58586395-58586417 ATGGAGGCCTTCAGGTCTCAGGG + Intronic
1101534345 12:105603861-105603883 GTGGAGACCTTCATTCCTGAAGG + Intergenic
1101594180 12:106149227-106149249 CTGGAGAACTTCAGGTTTGAAGG - Intergenic
1104332638 12:127861805-127861827 ATGGAGACCTTGTAGGCTGAGGG + Intergenic
1105966613 13:25390454-25390476 GGGGAGAACTTTAGGGGTGATGG - Intronic
1108122858 13:47208469-47208491 GCAGAGATCTTCAGGGCTGGGGG + Intergenic
1108530590 13:51323932-51323954 ATGGAGTGCTCCAGGGCTGAAGG - Intergenic
1112331481 13:98479990-98480012 TAGGAGACCTTCAGGGTTGAAGG - Intronic
1112331488 13:98480021-98480043 ATGGAGACCCTCACGGGTGAGGG - Intronic
1113313383 13:109154278-109154300 GTGGGGACCTTGAGAGCTCAGGG - Intronic
1114418178 14:22557764-22557786 GAGGAAACCTTCAGGGGTGGTGG + Intronic
1114956361 14:27824762-27824784 TTTGATACCTTCAGGGCTGTAGG - Intergenic
1115093186 14:29602939-29602961 GTAGAGCTCTTCAGAGCTGACGG - Intronic
1115787024 14:36837570-36837592 CTGGAGTCCTTGAGGGCTGTGGG + Intronic
1117348778 14:54860460-54860482 GTGGAGACCTTCTGTGCTGCAGG - Intronic
1118065650 14:62187514-62187536 GAGGAGTCCTTCAGATCTGAAGG - Intergenic
1118901534 14:69990196-69990218 GTGCAGACCTTCTTTGCTGATGG + Intronic
1121013442 14:90534842-90534864 GTGGAGAACTCCAAGGATGATGG + Exonic
1121494821 14:94385067-94385089 GTGCAGTCCTTCATGGCTTATGG + Intronic
1122135973 14:99633237-99633259 GGGGTGACCTTCTGGGCTGCAGG - Intergenic
1122225933 14:100279601-100279623 GTGGAGGTCTTCAGTGCCGAGGG + Exonic
1122454191 14:101837074-101837096 GTAGAGACTTTCAGGTTTGATGG + Intronic
1123680480 15:22759450-22759472 GTTGGGATCTTAAGGGCTGAAGG + Intergenic
1123744110 15:23305059-23305081 GTTGGGATCTTAAGGGCTGAAGG + Intergenic
1123986634 15:25652260-25652282 GAGGGAACCTTCTGGGCTGATGG + Intergenic
1125382272 15:39099428-39099450 GTGAAGAACTTGAGGGCTGCTGG + Intergenic
1126713036 15:51483077-51483099 GTGGTGGCCATGAGGGCTGATGG - Intronic
1127855478 15:62950269-62950291 GTAGAGGCCTCCAGGGCTGGAGG + Intergenic
1129504414 15:76069467-76069489 GAGGAGACCTTAAGAGCTCAAGG + Intronic
1129892564 15:79081308-79081330 GGGGAGACCTTTAGTGCTCATGG + Intronic
1131545370 15:93311667-93311689 ATGGAGAGCTTCAGGCCTGCAGG + Intergenic
1132572836 16:651482-651504 GAGGAGACTTTCAGGGCCTAGGG + Intronic
1133035183 16:3030429-3030451 GAGGTGACCTGCAGGGCTGGGGG - Exonic
1133809362 16:9149268-9149290 TCTGAGACCTTCAGGGCTGAGGG - Intergenic
1136284551 16:29233370-29233392 GTGGTGGCCTTGAGGGCTGGAGG + Intergenic
1141425274 16:83940750-83940772 GAGGAGACCCGCAGGGCTGGGGG + Intronic
1142089581 16:88202883-88202905 GTGGTGGCCTTGAGGGCTGGAGG + Intergenic
1142109941 16:88325880-88325902 GTGGCGTCCTTCAGGTCTAAGGG - Intergenic
1142312246 16:89320853-89320875 GTGGAGCCCCTCTGGGCTGCAGG - Intronic
1142333499 16:89471396-89471418 GTGGACTCCTTCAGGGCTGCAGG - Intronic
1145798805 17:27670838-27670860 GGGCAGACCCTAAGGGCTGAGGG + Intergenic
1146455622 17:33007258-33007280 GTGGAGATTTCGAGGGCTGAAGG - Intergenic
1148383179 17:47215346-47215368 CTGAAGACTTTCAGGGCTGATGG + Intronic
1149661334 17:58335545-58335567 GGGCAGAGCTTCAGGTCTGATGG + Intergenic
1150285180 17:63950171-63950193 GGGGACCCCTTCAAGGCTGAGGG + Intronic
1152054337 17:78011288-78011310 AAGGACACCTTCAGGGATGATGG - Intronic
1152564566 17:81094418-81094440 ATGGGGACCGTCAGGGCTCATGG + Intronic
1152742342 17:82023773-82023795 GTGGAGACCTGCAGGGCCCTGGG + Exonic
1155478662 18:26261852-26261874 GTGGAGAAGTTCAAGGCTAAAGG - Intronic
1156283366 18:35664216-35664238 AAGGAGACTTTCAGGGGTGATGG - Intronic
1158376657 18:56877808-56877830 GTGGTGACCTTTAGGGCAGGAGG + Intronic
1158403658 18:57142598-57142620 AGGGGGACATTCAGGGCTGATGG + Intergenic
1160472023 18:79144970-79144992 GTGGAGATTGTCAGGGCTGCTGG + Intronic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1160767524 19:815074-815096 GTGGACACCTGCAGGGCGGAAGG + Exonic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161456977 19:4374531-4374553 GTGGAGGCCTTCCGGGATGCAGG - Intronic
1162030984 19:7917139-7917161 CTGGAATCCTTCAGGGCTGGGGG + Intronic
1162252089 19:9454272-9454294 AATGAGACCTTCAGAGCTGACGG - Intergenic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1162441019 19:10692065-10692087 GTGGCGACCCTCAAGGCTGACGG - Exonic
1163668352 19:18613418-18613440 GGGGGGACCATCAGGCCTGAGGG - Intronic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1167357424 19:49012438-49012460 GAAGAGACCCCCAGGGCTGATGG + Intronic
1167472307 19:49682111-49682133 GGGGAGCCCATCAGGGCTCAGGG + Intronic
1168375659 19:55877295-55877317 GTGTAAAACTTCAGGGCTTAAGG + Intronic
1168494297 19:56837318-56837340 GTGGAAAAATTCAGGGCTGCGGG - Intronic
926933934 2:18067979-18068001 GGTGAGCCCTGCAGGGCTGACGG + Intronic
930347955 2:50209146-50209168 GTGGAGTACTCCAGGGGTGAAGG - Intronic
930870577 2:56166851-56166873 GTTGAGACCTTAAAAGCTGAAGG + Intergenic
934033451 2:88067889-88067911 GTGGAGGTCTTCACCGCTGAGGG + Exonic
934500790 2:94858539-94858561 GAGCAGACCTTCAGGTCTGGTGG - Intergenic
934934325 2:98453691-98453713 GAGGAGACTTTCAGTGGTGAGGG + Intronic
934936886 2:98472169-98472191 GTGGAGACCTACAGGGGCCAAGG + Intronic
935943044 2:108261586-108261608 GTGGATGCCAACAGGGCTGATGG + Intronic
935949364 2:108314768-108314790 GTGGAGACTTCCAGGGTTAAGGG + Intergenic
937952968 2:127402367-127402389 GTGGAGGCCTGCAGGCCTGCAGG - Intergenic
940327750 2:152443271-152443293 GTGGAGACCTGCAAGTCTGTCGG + Intronic
942711144 2:178837665-178837687 GTGGACACCTTCAGGTCTTGTGG + Exonic
943921263 2:193710412-193710434 GTGGAGACCACCACGGCTCAAGG - Intergenic
948491299 2:238314987-238315009 GTGGAGGCCTTGAGGGCACAGGG - Intergenic
948668297 2:239550074-239550096 ATGAAGACCTGCAGGGCTGCTGG + Intergenic
948765709 2:240217654-240217676 GTGGAGGTGGTCAGGGCTGAAGG - Intergenic
1168770114 20:409031-409053 TTGGAGACCTCCTGGGCTGGTGG + Intronic
1171332818 20:24356471-24356493 GTGGTGAGCCTCAGGTCTGAGGG - Intergenic
1172690391 20:36785784-36785806 GTGGAAACATGCAGGGCTCAGGG - Exonic
1173847627 20:46198061-46198083 CCTGAGACCTTGAGGGCTGATGG + Intronic
1175140240 20:56855535-56855557 GGGGAGACGTTCTGGGCAGAAGG - Intergenic
1175417899 20:58813617-58813639 GTGGGGACATTCTGGGATGAAGG - Intergenic
1175581377 20:60102406-60102428 CTGGAGACCTTCAGGGTAGCAGG + Intergenic
1175863148 20:62160866-62160888 GTGCAGACCTCCAGAGCTGCTGG + Intronic
1176267026 20:64215028-64215050 GCTGGGACCTGCAGGGCTGAAGG - Intronic
1176767999 21:13038613-13038635 GGGGAGCCCTGCAGGGCAGAGGG + Intergenic
1180085099 21:45504851-45504873 CTGGAGTCTTTCAGGACTGATGG - Intronic
1180169374 21:46050014-46050036 GTGTTGACCTCCAGGGATGAGGG - Intergenic
1182469420 22:30538944-30538966 GTTGAGACCTGCAGGACCGAGGG - Intronic
950536886 3:13583915-13583937 GTGAAGACCCTTAGGGATGAGGG + Intronic
950557580 3:13704743-13704765 GTGGAGACCTTCATGTGAGAAGG + Intergenic
950615428 3:14154165-14154187 GTGGAGACCTTGTGGACTGTCGG + Intronic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961006656 3:123410129-123410151 GTGGAGGCCCTGAGGGCAGATGG - Intronic
963785218 3:149527725-149527747 GTGGGGAGCTTGAGGGTTGAGGG - Intronic
964636346 3:158861509-158861531 GCCAAGACCTTGAGGGCTGAAGG - Intergenic
966221352 3:177554414-177554436 CTGTAGACTTTCAGTGCTGAAGG + Intergenic
969640381 4:8394851-8394873 GTGAAGACCTTCAGCGCTAGTGG - Intronic
972056102 4:34805525-34805547 GTTAAGACCTTCAGGACTGTTGG - Intergenic
976679863 4:87745024-87745046 CTGGAAACCTTCATGGCTGGCGG + Intergenic
981193267 4:141888088-141888110 GTGGAGCCATTCAGGCCTGCAGG - Intergenic
981335354 4:143563005-143563027 GTGGAAACCTACAAGGCTTATGG - Intergenic
984829384 4:183957784-183957806 GTGGTTTCCTTCAGGGCGGATGG + Intronic
985838985 5:2291484-2291506 ATGGATTCCTGCAGGGCTGAAGG + Intergenic
986391478 5:7291419-7291441 GTTGGGATCTTAAGGGCTGAAGG + Intergenic
986628832 5:9749303-9749325 GTGTAGACCTTAAATGCTGAGGG + Intergenic
986841790 5:11706079-11706101 GTTCAGACCTCCAGGTCTGAGGG - Intronic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
995674558 5:114648738-114648760 GTGGAGACCATAATGGGTGAGGG + Intergenic
995968779 5:117941569-117941591 CTGGAGACCTGCAGAGCTAATGG - Intergenic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
999210277 5:149882215-149882237 TTGGACAACTGCAGGGCTGAAGG + Intronic
999906763 5:156149687-156149709 GTGGGGACCTTGAGAGCTGGTGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000671707 5:164071444-164071466 GAGGAGACATTCAGGGATCAAGG - Intergenic
1002173858 5:177390580-177390602 CTGGTGGCCTTCAGGCCTGATGG - Intronic
1003417974 6:5929982-5930004 GAGGACACCTTCAGGTCTGGAGG - Intergenic
1004760849 6:18664433-18664455 CTGGGGACCTTCTGGTCTGAGGG - Intergenic
1005863826 6:29923369-29923391 GTGTAGACCTCCTGGGCTCAAGG + Intergenic
1006919641 6:37619040-37619062 GTGGAGTGCTGCAGGGCAGAGGG + Intergenic
1007120174 6:39373364-39373386 GTGGAGGCCTTCAATGCTGCTGG + Intronic
1007851045 6:44803104-44803126 GAAGAGACCCTCAGGGCTGGTGG - Intergenic
1009774070 6:68181842-68181864 ATGGAAACCTTCAGGGGTGGTGG + Intergenic
1010011315 6:71051273-71051295 GTGCAGACCCCGAGGGCTGACGG + Intergenic
1010929451 6:81783200-81783222 GAGGAGAACTTGATGGCTGAAGG - Intergenic
1016823590 6:148367900-148367922 GTGGAGTCGTTCAGGGCTGCGGG + Intronic
1017653226 6:156601843-156601865 GTGGGGGCCTGCAGGGCTGTAGG - Intergenic
1018082371 6:160269728-160269750 GTGGAGAGCTTCTGGGTTGTTGG + Intronic
1018550841 6:164997064-164997086 GTGCAGACATCCGGGGCTGAGGG - Intergenic
1018890759 6:167979841-167979863 GTGGAAACATTCAAGCCTGAAGG + Intergenic
1018905191 6:168071882-168071904 GTGCTGACCTTCAGGACTCAAGG + Intronic
1019569682 7:1705049-1705071 GTGGAGACCTGCTGGGGTGGGGG + Intronic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1022323613 7:29309837-29309859 GTGGAGACCTCGCGGGCTCATGG + Intronic
1022537325 7:31106343-31106365 CTGGAGACCTTGAGGGCCGCAGG + Intronic
1023146950 7:37160800-37160822 ATGAAGACCATCAGGCCTGAAGG - Intronic
1023277787 7:38539203-38539225 GTGGACACTTTCAGGGCTTTTGG - Intronic
1024122400 7:46257882-46257904 GGGAATACCATCAGGGCTGATGG - Intergenic
1024593894 7:50916297-50916319 GTAGCAACATTCAGGGCTGAAGG - Intergenic
1025009576 7:55385236-55385258 GTGGCGACTTTCTGGGCTGGTGG + Intronic
1025208657 7:57008267-57008289 CTGGAGACCTGCAGGGCCGCCGG - Intergenic
1025663290 7:63568611-63568633 CTGGAGACCTGCAGGGCCGCCGG + Intergenic
1029477653 7:100794472-100794494 GTGCTAACCATCAGGGCTGAAGG - Intronic
1029737479 7:102472778-102472800 GTGGGGGCCTGCAGGGCTGCCGG - Exonic
1030100439 7:105940850-105940872 GGAGAGACCTACAGAGCTGAAGG - Intronic
1030212157 7:107007060-107007082 GAGGACATTTTCAGGGCTGAGGG - Intergenic
1034925721 7:155119943-155119965 GTGGAGTCCTTCACGGCAGCTGG - Intergenic
1035044441 7:155954437-155954459 ATGGAGACCTTCAAGACTGCAGG + Intergenic
1035761533 8:2072309-2072331 ATGGAGGCTTTCAGGGCCGAAGG - Intronic
1037560500 8:20069776-20069798 TTGGAGACTTGCAGGGGTGAGGG + Intergenic
1037597215 8:20364227-20364249 ATGAAGAGCCTCAGGGCTGAGGG + Intergenic
1037871321 8:22499537-22499559 GTGTAGAACTCCTGGGCTGAAGG - Intronic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1040551584 8:48442017-48442039 GTGGAGGGGTTCAGCGCTGATGG + Intergenic
1043908746 8:85836291-85836313 GCGGAGTTCTTCAGGGCAGAGGG + Intergenic
1044860259 8:96515980-96516002 GGGGAGCCCTTCCAGGCTGATGG + Intronic
1046806879 8:118488488-118488510 GGGGAAACCTTCTGGGATGATGG - Intronic
1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG + Intronic
1049090328 8:140509791-140509813 GAGCTGACCTTCAGGTCTGAGGG - Intergenic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1050499150 9:6276534-6276556 GTGGCCGCCTTGAGGGCTGAGGG + Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1056977313 9:91270263-91270285 ATGGAGACTTCCAGGGCTGCTGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057891108 9:98870532-98870554 CCAGAGTCCTTCAGGGCTGATGG - Intergenic
1057930950 9:99192482-99192504 CTGAAGATCTTCAGGGCTAAGGG - Intergenic
1059338101 9:113581637-113581659 GTGGACACCTTGAGGCCTAAAGG + Intronic
1061191041 9:129082910-129082932 GTGCAGAGCTTGAGGTCTGACGG - Intronic
1061862277 9:133474096-133474118 GGGGAGACCACCAGGGCTGAGGG + Intronic
1062168871 9:135123059-135123081 GTGAGGACTTTCAGGGCTGGAGG + Intergenic
1062266421 9:135688426-135688448 GGGGATGCCCTCAGGGCTGACGG - Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062451422 9:136617314-136617336 GGGGAGACCCTCAGGACTGCAGG + Intergenic
1062476969 9:136733060-136733082 GTGGAGCCCTGCAGGGCTGCTGG + Intergenic
1187877492 X:23816335-23816357 AAGCAGACCTGCAGGGCTGAGGG - Intergenic
1189232383 X:39462586-39462608 GTGGAGAGCTTCAGAGGTGGAGG + Intergenic
1191568480 X:62572686-62572708 TTGGAGACCTTCACGGCCAATGG + Intergenic
1191846525 X:65551387-65551409 GTGCACACCTTCCAGGCTGATGG + Intergenic
1194024950 X:88739612-88739634 GTGGAAGCCGTCAGGGCTTATGG + Intergenic
1199268547 X:145856214-145856236 TTGGAGACCTTCCTTGCTGAGGG + Intergenic
1199856379 X:151762185-151762207 TTGCACACCTCCAGGGCTGAGGG - Intergenic