ID: 1163760323

View in Genome Browser
Species Human (GRCh38)
Location 19:19132931-19132953
Sequence TCAAGTTAGCATCTGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163760323_1163760324 -5 Left 1163760323 19:19132931-19132953 CCAGGAAACAGATGCTAACTTGA 0: 1
1: 0
2: 3
3: 32
4: 227
Right 1163760324 19:19132949-19132971 CTTGACAGTGACCATCTCCTTGG 0: 1
1: 0
2: 3
3: 15
4: 180
1163760323_1163760326 2 Left 1163760323 19:19132931-19132953 CCAGGAAACAGATGCTAACTTGA 0: 1
1: 0
2: 3
3: 32
4: 227
Right 1163760326 19:19132956-19132978 GTGACCATCTCCTTGGACTAGGG 0: 1
1: 0
2: 0
3: 9
4: 85
1163760323_1163760328 10 Left 1163760323 19:19132931-19132953 CCAGGAAACAGATGCTAACTTGA 0: 1
1: 0
2: 3
3: 32
4: 227
Right 1163760328 19:19132964-19132986 CTCCTTGGACTAGGGTCTCCCGG 0: 1
1: 0
2: 0
3: 18
4: 150
1163760323_1163760325 1 Left 1163760323 19:19132931-19132953 CCAGGAAACAGATGCTAACTTGA 0: 1
1: 0
2: 3
3: 32
4: 227
Right 1163760325 19:19132955-19132977 AGTGACCATCTCCTTGGACTAGG 0: 1
1: 0
2: 1
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163760323 Original CRISPR TCAAGTTAGCATCTGTTTCC TGG (reversed) Intronic
901359948 1:8688912-8688934 TCAACTTAGGATGGGTTTCCTGG + Intronic
905333863 1:37229819-37229841 TTAACTTAGCATATTTTTCCAGG + Intergenic
907950954 1:59183313-59183335 TCAAATGAGAATCTGTCTCCAGG - Intergenic
908051602 1:60238829-60238851 TCTAGTTAGGGCCTGTTTCCTGG + Intergenic
908398019 1:63744136-63744158 TTAAATGAACATCTGTTTCCTGG + Intergenic
910845033 1:91596604-91596626 GCAAGTTATCATCTTTTTGCTGG + Intergenic
913941002 1:125105588-125105610 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
914443100 1:147723948-147723970 TAAAGACAGCTTCTGTTTCCTGG - Intergenic
915772534 1:158443098-158443120 TAAAGGTAGCATTTTTTTCCAGG + Intergenic
916089423 1:161295811-161295833 TCAAATAGGCATCTGCTTCCAGG - Intergenic
916403163 1:164470514-164470536 TCAATTTGGCATCTGCTTCTTGG - Intergenic
916575394 1:166062505-166062527 GCAAGAAAGCATCTGTTCCCAGG - Intronic
916847200 1:168664019-168664041 GCAAGTTGTCATCTTTTTCCTGG - Intergenic
917409169 1:174740475-174740497 TCAATTCATCAGCTGTTTCCAGG + Intronic
918841194 1:189541800-189541822 TCAAGTTAGAACCTGCTTCCTGG - Intergenic
920590721 1:207216130-207216152 TCTAGCTAGCATGTGTTGCCAGG - Intergenic
920861869 1:209715561-209715583 TAAAGTTGGCCTCTGTGTCCTGG - Intronic
921795117 1:219333860-219333882 GCAAGTTGGCAGCTGTCTCCTGG - Intergenic
922448311 1:225716474-225716496 TCATGTTGGCATCTCTTTCTTGG - Intergenic
924856701 1:247881435-247881457 GCAAGGCAGCATCTGCTTCCAGG - Intergenic
1063089017 10:2845159-2845181 TCTAGTGAGGACCTGTTTCCTGG - Intergenic
1063345040 10:5303781-5303803 TCAGGTGAGGGTCTGTTTCCTGG - Intergenic
1063986204 10:11505836-11505858 TCGAGTGAGCCTCTGTTTCATGG - Intronic
1065211008 10:23402973-23402995 ACAATTTAACATCTGTTCCCTGG - Intergenic
1065872911 10:29971390-29971412 TGGTGTTAGCATCTGCTTCCAGG + Intergenic
1066982720 10:42433963-42433985 TTAAGTTGTCATCTGTTTTCAGG - Intergenic
1067268668 10:44770538-44770560 TCATCTCAGCATCAGTTTCCTGG - Intergenic
1069758639 10:70791936-70791958 TAAAGTTGTCATCTGGTTCCAGG - Intergenic
1071846408 10:89525675-89525697 TTAAGTTAGTAGCTGTTGCCAGG + Intronic
1072050488 10:91698884-91698906 TCAAGTGAGCATCTGTCCTCGGG + Intergenic
1072282566 10:93881047-93881069 CAAAGTTGGCATCTGGTTCCAGG - Intergenic
1072285516 10:93910640-93910662 TTAAGTTAGAATTTGTTTCTGGG + Intronic
1075360682 10:121830200-121830222 TCATGTTGGAATCTGATTCCTGG + Intronic
1079982900 11:27170323-27170345 TTATCTTAGCATCTGCTTCCAGG + Intergenic
1080069482 11:28063183-28063205 TTAAGGTAGCATTTGTTTCAAGG - Intronic
1085971888 11:81602596-81602618 TCAAGAAAACATCTGTTGCCAGG - Intergenic
1087229893 11:95648861-95648883 TAAAGTTCTCTTCTGTTTCCTGG + Intergenic
1089806186 11:121092974-121092996 CCACCTTAGCATCTGCTTCCTGG - Intergenic
1090533378 11:127614507-127614529 TCAAGTTATTATCTTTTGCCTGG + Intergenic
1091080220 11:132659449-132659471 TCAATTTAGCATCTAATTCCAGG - Intronic
1091369830 11:135048686-135048708 TAAAGTTGGCATCTGGTTCCAGG - Intergenic
1092400471 12:8172035-8172057 TCAAGTAAGAATCTGTTTTAGGG - Intronic
1094737824 12:33255057-33255079 TAAAGTCAGCATCTGGTTCCAGG - Intergenic
1096165422 12:49418799-49418821 ACAAATTAGCATGTGTTTGCAGG - Intronic
1096546481 12:52343675-52343697 CCAGGGGAGCATCTGTTTCCAGG + Intergenic
1097237802 12:57551582-57551604 TCAAGCTAGTTTTTGTTTCCTGG - Intronic
1097817048 12:64086277-64086299 TCAAGTTTGCATGTGTTTATCGG - Intronic
1098404858 12:70113906-70113928 TGAGGTCAGCATCTGTTTCAGGG - Intergenic
1098915994 12:76257447-76257469 GCAAGTTAGCATCTGTGTGGTGG + Intergenic
1100151097 12:91738743-91738765 TCAAGCTAGCATCTATTTTCAGG + Intergenic
1100427323 12:94499327-94499349 TAAAGTTGGCATCTGGTTCCAGG + Intergenic
1100775673 12:97970927-97970949 TCAAGTTAACTTTTTTTTCCTGG - Intergenic
1102156811 12:110736567-110736589 TCAATGCAGCATCTGTCTCCCGG - Intronic
1102330274 12:112022790-112022812 TCATGTTAGCATCAATGTCCAGG - Exonic
1103094284 12:118120369-118120391 TAAAGCTGGCATCTGGTTCCAGG - Intronic
1103604336 12:122076099-122076121 AAAAGTTAACATCAGTTTCCTGG - Intergenic
1104079519 12:125417751-125417773 CCAAGTTAGCAGATGTTTGCTGG - Intronic
1104132511 12:125908148-125908170 TAAATTTAACAACTGTTTCCTGG - Intergenic
1106845932 13:33737795-33737817 TAAAGTCAGCATCTGATTCCAGG + Intergenic
1106899580 13:34341014-34341036 TCCACTTAGCATCTCCTTCCTGG + Intergenic
1111378073 13:87407296-87407318 TCAAGAAAGAGTCTGTTTCCTGG + Intergenic
1112103320 13:96214051-96214073 TCAAGTTAGTAACTCCTTCCTGG - Intronic
1112158814 13:96847750-96847772 TCTTGTTAGCATGTGGTTCCTGG + Intergenic
1117713370 14:58555686-58555708 TCAAGTTAGCATCCATTTGATGG + Intergenic
1117872591 14:60216933-60216955 TCCAGTTAGCACCAGCTTCCAGG - Intergenic
1118864085 14:69688984-69689006 AGAAGTTAGCAAATGTTTCCAGG - Intronic
1121218012 14:92263729-92263751 GCAATTTAGCAGCTGTTTCCAGG - Intergenic
1124397308 15:29314456-29314478 GCAAGTTGTCATCTGTTTGCTGG - Intronic
1130662950 15:85845078-85845100 TCCTGTTAGCCTCTGTTCCCAGG - Intergenic
1131457221 15:92591052-92591074 TCCATTAAGAATCTGTTTCCAGG - Intergenic
1131481668 15:92787551-92787573 TCTAGTGAGCATCAGTATCCAGG - Intronic
1131832780 15:96364892-96364914 CCAACTTAGCATCAGTTTGCAGG + Intergenic
1132360623 15:101210925-101210947 ACATCTTATCATCTGTTTCCTGG - Intronic
1133914982 16:10101299-10101321 CCATCTCAGCATCTGTTTCCTGG + Intronic
1136697449 16:32097524-32097546 TAAAGTAAGCATCTCTTTGCTGG - Intergenic
1136797947 16:33040810-33040832 TAAAGTAAGCATCTCTTTGCTGG - Intergenic
1136958785 16:34820318-34820340 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
1137085381 16:36114417-36114439 TAAAGTAAGCATCTCTTTGCTGG - Intergenic
1137764822 16:50969993-50970015 AAATGTTGGCATCTGTTTCCAGG + Intergenic
1137796925 16:51229244-51229266 TCCAATTAGCATCTGCCTCCTGG - Intergenic
1138851490 16:60634747-60634769 TAAAGCAAGCATCTGGTTCCAGG - Intergenic
1141298669 16:82793001-82793023 TCAAGTCTGCTTCTGCTTCCTGG - Intronic
1141742187 16:85901077-85901099 ACAAGTTAGCAGCTCTTTCCTGG - Intronic
1141817866 16:86425251-86425273 TCAAGTTAGGTTGTATTTCCTGG - Intergenic
1142208094 16:88793482-88793504 TCAAGAAAGCGTGTGTTTCCGGG + Intergenic
1143801220 17:9383104-9383126 TCTGGTGAGGATCTGTTTCCTGG - Intronic
1144238182 17:13283394-13283416 TGAAGTTACCTTCTGTCTCCAGG + Intergenic
1145115748 17:20209842-20209864 TCAAGTTAGAATATCTTTTCTGG + Intronic
1145689310 17:26719766-26719788 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
1147224933 17:38969134-38969156 TGAAGTCTGCCTCTGTTTCCCGG + Intergenic
1147253551 17:39167676-39167698 GCATTTTACCATCTGTTTCCTGG + Intergenic
1149768287 17:59298630-59298652 TAAAGTCTGCATCTGGTTCCAGG + Intergenic
1150684623 17:67310570-67310592 TCAATGTAGCTTCTGTCTCCCGG - Intergenic
1151973999 17:77474283-77474305 TCAAGTAAGCATCTGTGTCCTGG + Intronic
1152049634 17:77962125-77962147 TCAAGTTAGCATCACTTTCCTGG - Intergenic
1152363487 17:79842885-79842907 TCAAGTTGGTATCGTTTTCCCGG + Intergenic
1203182494 17_KI270729v1_random:75412-75434 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
1157321787 18:46640257-46640279 TCTAGTTGGCTTCTGCTTCCTGG - Intronic
1158184924 18:54760577-54760599 TCAAGTCATCATCTGTTGCCTGG - Intronic
1160019540 18:75169775-75169797 CCTAGTTAGAATCTGTTTTCTGG - Intergenic
1160338652 18:78067289-78067311 GCAAGTTGACATCTGTTTTCTGG + Intergenic
1163513335 19:17748544-17748566 TACAGCTAGCATCTGTTTCTGGG + Intronic
1163760323 19:19132931-19132953 TCAAGTTAGCATCTGTTTCCTGG - Intronic
1168213205 19:54906581-54906603 GCAAGTGACCATCTGTTGCCAGG + Exonic
1202668677 1_KI270709v1_random:27314-27336 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
926886747 2:17605262-17605284 TCAAGTTAGGATCTGCTCCAGGG + Intronic
926888063 2:17615951-17615973 TCCAATTATCATCTATTTCCTGG + Intronic
927077671 2:19596371-19596393 TAAATTTGGCATCTCTTTCCAGG + Intergenic
928164394 2:28959144-28959166 TCGGGTTAGCATCTGTAGCCCGG - Intronic
928479350 2:31666359-31666381 CCAAGTTAGAATCTGTTCCATGG + Intergenic
928948289 2:36791714-36791736 TCCAGGGAGAATCTGTTTCCTGG - Intronic
929095931 2:38263335-38263357 GCATGGTAGCATCTGCTTCCAGG + Intergenic
929551651 2:42897015-42897037 TCAATTTAGCAGCAGTTTCTGGG + Intergenic
930117219 2:47728606-47728628 TAAAGTCAGCATCTGGTTCCAGG - Intronic
930194838 2:48498941-48498963 TCTGGTTAGGGTCTGTTTCCTGG + Intronic
930417435 2:51106364-51106386 TAAAACTAGCCTCTGTTTCCTGG + Intergenic
931620510 2:64205292-64205314 TCAAGTCAGCAGCTTTTTCCAGG - Intergenic
931622896 2:64228942-64228964 TCAAGCTAGAATCTGAATCCAGG - Intergenic
933098404 2:78218163-78218185 TAAAGTAGGCATCTGGTTCCAGG + Intergenic
933374635 2:81464039-81464061 GCACCTTAGCATCTGTTTCTGGG + Intergenic
934256823 2:91430388-91430410 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
935412575 2:102781161-102781183 TAAAGTTAACTTCTGCTTCCAGG - Intronic
935950609 2:108325337-108325359 TCAACTCAGAATCTGCTTCCTGG - Intergenic
936696757 2:114959355-114959377 TTCAGTTAGCATATATTTCCAGG + Intronic
936915056 2:117631743-117631765 TCAAGGTGGCACCAGTTTCCAGG - Intergenic
937443950 2:121940887-121940909 CCAAGGTGGCATCTGTATCCCGG + Intergenic
940259323 2:151764083-151764105 TCAAGTTTCCCTCTGTTTGCTGG + Intergenic
940500516 2:154487936-154487958 TCACTGTAGCATCTATTTCCTGG - Intergenic
941993177 2:171576707-171576729 TAAAGTCAGCTTCTGGTTCCAGG - Intergenic
942882600 2:180880149-180880171 TCAGGTGAGGACCTGTTTCCTGG + Intergenic
943300742 2:186195685-186195707 TCCAGTTACCATCTCTTTCTTGG - Intergenic
944444456 2:199775439-199775461 TCAAGTTTTCATCAGTTCCCAGG - Intronic
944909629 2:204297021-204297043 TCAAGGTCACATCTGTTTTCTGG - Intergenic
947219058 2:227775690-227775712 TGGAGTCAGGATCTGTTTCCGGG - Intergenic
948586745 2:239024543-239024565 TCATGTTTCCATCTGTTTTCTGG + Intergenic
948881230 2:240858207-240858229 TAAAGTTGGCACCTGGTTCCAGG + Intergenic
948882542 2:240867577-240867599 TAAAGTTGGCACCTGGTTCCAGG + Intergenic
1168823078 20:789909-789931 TAAAGTTGGCATCTGGTTCCAGG - Intergenic
1168942578 20:1725990-1726012 TCAAGTTAGGATGGGTTTACTGG - Intergenic
1169187854 20:3633944-3633966 TCAAGTTAGCAGATATTTACTGG - Intronic
1169666944 20:8048139-8048161 TAAAGTTGTCATCTGTTTCCTGG + Intergenic
1170425918 20:16235589-16235611 TCATCTTAGGATCTGTTTCTGGG - Intergenic
1170877724 20:20266574-20266596 TCAATTGACCATCTATTTCCAGG - Intronic
1171287287 20:23951617-23951639 CCATTTCAGCATCTGTTTCCAGG + Intergenic
1174219052 20:48937702-48937724 TCCAGGTAGCAACTCTTTCCTGG + Intronic
1175605385 20:60308334-60308356 ACCTGTAAGCATCTGTTTCCCGG - Intergenic
1176944778 21:14966222-14966244 TCCAGTTAACAGCTGTTTGCTGG + Exonic
1177360145 21:20057730-20057752 TAAAGTCAGCATCTGGTTCCAGG - Intergenic
1184368961 22:44070496-44070518 ACAAGATAGGAGCTGTTTCCTGG + Intronic
1184397804 22:44255004-44255026 TCAAGTGATCACCTGCTTCCAGG + Intronic
1184765212 22:46568681-46568703 CCAACTTAACACCTGTTTCCAGG - Intergenic
1185358139 22:50387423-50387445 TAAAGTTAGACTCTTTTTCCTGG + Intronic
1203288001 22_KI270735v1_random:833-855 TAAAGTAAGCATCTCTTTGCTGG - Intergenic
949248967 3:1959736-1959758 TAATTTTAGCATCTGTTTCTTGG - Intergenic
950173846 3:10857660-10857682 TAGAGTAAGCATTTGTTTCCTGG - Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
951521013 3:23610743-23610765 ACAAATTAGCATATTTTTCCAGG - Intergenic
951844794 3:27073606-27073628 CCAACTCAGCATCTGTTTCTGGG + Intergenic
952018767 3:28991376-28991398 TAAGATTAGCATTTGTTTCCGGG - Intergenic
954376033 3:50194623-50194645 GCACCTCAGCATCTGTTTCCCGG + Exonic
954669615 3:52282528-52282550 TAAAGTGGGCATCTGGTTCCAGG - Intronic
955515643 3:59723982-59724004 TCTGGTGAGCACCTGTTTCCTGG + Intergenic
957451131 3:80384394-80384416 TCTGGTTAGCATCCGTTTCTGGG + Intergenic
958004032 3:87789955-87789977 TCAAATAAGCAACTGTTTCCTGG - Intergenic
960668363 3:120132697-120132719 TCAAGATGGCAAATGTTTCCTGG - Intergenic
961152530 3:124651410-124651432 TTAATTTTGCATCTGTTTCTGGG + Intronic
964254705 3:154762834-154762856 GCAAAATAGCATCTGTTTCAAGG + Intergenic
964308257 3:155363329-155363351 TAAAGTCAGCACCTGGTTCCAGG + Intergenic
969779652 4:9389555-9389577 TCAAGTAAGAATCTGTTTTAGGG + Intergenic
970914324 4:21315031-21315053 TCCAGTTAGGATTTGTGTCCAGG - Intronic
971701287 4:29980571-29980593 TCAAGTTTTCATTTGTTTCCTGG + Intergenic
972053891 4:34775214-34775236 TCAAGTGGGCATCTGATTCCAGG - Intergenic
975745431 4:77470480-77470502 TCATCTCAGCATCTGTTTCCTGG + Intergenic
976747048 4:88413858-88413880 ACAAGTTAATTTCTGTTTCCTGG - Intronic
977255148 4:94732349-94732371 CCATCTCAGCATCTGTTTCCAGG - Intergenic
978661120 4:111127797-111127819 CCAGGTAAGAATCTGTTTCCTGG + Intergenic
979591182 4:122482285-122482307 TAAAGCCAGCATCTGGTTCCAGG - Intergenic
980839106 4:138236034-138236056 TCAAGTAAGCATCTTTCTCCTGG + Intronic
981127497 4:141123407-141123429 TAAAGCCAGCATCTGGTTCCAGG + Intronic
984520949 4:180799988-180800010 TCAAGTTAAGATCTGTTTACAGG - Intergenic
984685757 4:182666517-182666539 TCAAGTCATCATCTTTTTGCTGG - Intronic
991607564 5:68418990-68419012 CCAAGGTGGCATCTGTTTCCAGG - Intergenic
991949276 5:71932213-71932235 TTAAGGTAGGAGCTGTTTCCTGG + Intergenic
993229126 5:85209429-85209451 TCATTTTATCATTTGTTTCCCGG - Intergenic
995189486 5:109305491-109305513 TGAAGATGCCATCTGTTTCCTGG + Intergenic
996143332 5:119942107-119942129 TCAATGTACCATCTGTTGCCTGG + Intergenic
997453663 5:134002889-134002911 TCATGGCAGCTTCTGTTTCCTGG - Intronic
997909826 5:137860433-137860455 TCAATTTTGTATTTGTTTCCAGG + Intergenic
1000351601 5:160356906-160356928 TCCCCTCAGCATCTGTTTCCAGG - Intronic
1000405673 5:160886078-160886100 TAAAAGTAGCGTCTGTTTCCTGG - Intergenic
1000699597 5:164432225-164432247 TCAAGATTGCAGCTGGTTCCTGG + Intergenic
1001074770 5:168617551-168617573 TAAAGTCAGCACCTGGTTCCAGG + Intergenic
1001938594 5:175725189-175725211 TAAAGTCAGCGTCTGGTTCCAGG - Intergenic
1002561598 5:180086006-180086028 TGACGTCAGCATCTGTTTCAGGG + Intergenic
1002987807 6:2207941-2207963 CCAAGTTAGTAGCTTTTTCCAGG + Intronic
1006885863 6:37381762-37381784 GCAAGTCAGCATCAGATTCCTGG - Intronic
1007555183 6:42759819-42759841 TGAAGTCAGTATCTGTTTACAGG + Intronic
1007689239 6:43688016-43688038 TCAAGGTTGCATTCGTTTCCTGG + Intergenic
1008113040 6:47514558-47514580 TCAACTAAGCATTTGTTTACTGG - Intronic
1009841235 6:69077361-69077383 TCAAGATAGCACATGTTTCTTGG - Intronic
1010010274 6:71040781-71040803 TAAAGTCAGCATGTGGTTCCAGG - Intergenic
1010762916 6:79745193-79745215 TCATGTTGGCATCTGTATCTTGG + Intergenic
1010811081 6:80299389-80299411 TCAAGTTAGCCTTTGGTTCGGGG + Intronic
1011991081 6:93518649-93518671 TCTAGTGAGGACCTGTTTCCTGG + Intergenic
1012320074 6:97832566-97832588 TTGAGTGAGCATCTGTCTCCTGG - Intergenic
1014368237 6:120572355-120572377 TCATCTCAGAATCTGTTTCCAGG - Intergenic
1014667411 6:124256439-124256461 GCCAGTTTACATCTGTTTCCTGG - Intronic
1014772236 6:125469937-125469959 TCAAGTTCTCATCTGTTTAATGG + Intergenic
1017173773 6:151482715-151482737 TCAAGTTATCATCTTTTTGGAGG + Intergenic
1017517408 6:155169287-155169309 TTAAGTTAGCATTTGTGGCCGGG - Intronic
1018730850 6:166649400-166649422 TCTAACTAGAATCTGTTTCCGGG + Intronic
1020852343 7:13371977-13371999 TCCAGATAGCATATGTTTTCTGG - Intergenic
1020978572 7:15039039-15039061 TTCAGTCAGTATCTGTTTCCAGG - Intergenic
1021386632 7:20039195-20039217 TCAAGGCAGCCTCTGCTTCCCGG + Intergenic
1021794251 7:24237463-24237485 TAAAGCAAGCATCTGGTTCCAGG + Intergenic
1022862768 7:34385072-34385094 TTAACTTAGCTTCTGTTTCTTGG + Intergenic
1022985784 7:35652058-35652080 TAAAGTCAGCATATGATTCCAGG + Intronic
1024969756 7:55057828-55057850 TGAAGATAGCCTCTGTTTTCAGG + Intronic
1025554520 7:62288331-62288353 TAAAGTAAGCATCTCTTTGCTGG - Intergenic
1025560261 7:62364943-62364965 TAAAGTAAGCATCTCTTTGCTGG + Intergenic
1028069846 7:86437664-86437686 CCATTTTAGCATCTGCTTCCAGG + Intergenic
1033763433 7:144461707-144461729 TCATGTCAGCATCTGCTTCTGGG - Intronic
1035939432 8:3880403-3880425 CCAAATTAGCTTCAGTTTCCAGG + Intronic
1036277086 8:7363518-7363540 TCAAGTAAGAATCTGTTTTAGGG + Intronic
1036344248 8:7946828-7946850 TCAAGTAAGAATCTGTTTTAGGG - Intronic
1036662817 8:10718843-10718865 TCAAGCTAGTATCTGCCTCCAGG + Intergenic
1036780691 8:11644961-11644983 CCATGTTAGCATCTGTTTCTGGG + Intergenic
1036839590 8:12107600-12107622 TCAAGTAAGAATCTGTTTTAGGG - Intronic
1036861381 8:12353840-12353862 TCAAGTAAGAATCTGTTTTAGGG - Intergenic
1036991443 8:13601299-13601321 ATAAGATAGCATCTGTTTACTGG - Intergenic
1037003693 8:13750670-13750692 TCATGTTAGAATCTCTTTCCAGG + Intergenic
1037939240 8:22939235-22939257 TCAACCTAGAATCTGTATCCAGG + Intronic
1038123384 8:24643160-24643182 AAAAATTAGCATCTGTTTCTGGG - Intergenic
1038982736 8:32777231-32777253 TAAAGTCAGCATCTGGTTCCAGG - Intergenic
1040870603 8:52096952-52096974 TCACCTCAGCATCTCTTTCCTGG + Intergenic
1041828813 8:62129036-62129058 TCAATTGAGCATTAGTTTCCTGG - Intergenic
1045181087 8:99783305-99783327 TCCAGTTGGCCTCTATTTCCTGG - Intronic
1046139525 8:110072126-110072148 TCATATTAACAACTGTTTCCAGG + Intergenic
1046177029 8:110589995-110590017 TGGAGTCAGCATCTGTTTCAGGG - Intergenic
1047578148 8:126181310-126181332 TCAAATTAGGAGCTGTTTCCTGG - Intergenic
1050810062 9:9733675-9733697 TCAAGTTAGAATCTCATTCTTGG + Intronic
1050990544 9:12145868-12145890 TAAAGTCAGCATCTTGTTCCAGG + Intergenic
1051608336 9:18938346-18938368 GCATGGTAGCATCTGTTTCTGGG + Intronic
1051761576 9:20472258-20472280 TCAAGTTACCATGTATTTCCTGG + Intronic
1054877848 9:70115073-70115095 TAAAGTTAAAATCTCTTTCCTGG - Intronic
1055712868 9:79083721-79083743 TAAAGTACGCATCTGGTTCCAGG + Intergenic
1056258399 9:84823915-84823937 TCATCTCAGCATCTGTTTCCAGG - Intronic
1057115981 9:92522574-92522596 TCAAGTTATAATGTGTTACCAGG - Exonic
1058001944 9:99874919-99874941 TTAACTTTGCATCTGTTTTCAGG + Intergenic
1059222460 9:112637747-112637769 TAAAGATATCATCTGTTTTCTGG + Intronic
1059530143 9:115027993-115028015 TCAAGCAAGCATCTGGTTCCAGG + Intronic
1185946675 X:4384720-4384742 TAAAGTCAGCATCTGGTTCCAGG - Intergenic
1186168862 X:6856318-6856340 TGCAGTGAGCACCTGTTTCCAGG + Intergenic
1186373157 X:8967491-8967513 CTAAGTTGGCATCTGGTTCCAGG - Intergenic
1188756247 X:33968137-33968159 TCATGTTAGCATCTGCTTTCTGG - Intergenic
1193807496 X:86012447-86012469 TAAAGTTGACATCTGATTCCAGG + Intronic
1194365065 X:93004679-93004701 TCATGATAGCATCTGCTTCTGGG - Intergenic
1195669007 X:107453444-107453466 TCAAGTCAGCTTCTGTTTGTGGG + Intergenic
1196896153 X:120338300-120338322 TCCATTTAGCATCTGTTTACTGG - Intergenic
1199362711 X:146942127-146942149 TAAAGCAAGCATCTGGTTCCAGG - Intergenic
1200673293 Y:6120939-6120961 TCATGATAGCATCTGCTTCTGGG - Intergenic
1201342211 Y:12946978-12947000 TCACTGTAGCCTCTGTTTCCAGG + Intergenic
1201733887 Y:17236310-17236332 TAAAGGTAGCATCTGTTTCCAGG - Intergenic