ID: 1163761082

View in Genome Browser
Species Human (GRCh38)
Location 19:19137224-19137246
Sequence CTGAGCTGTGGGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 0, 2: 17, 3: 107, 4: 781}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163761082_1163761091 12 Left 1163761082 19:19137224-19137246 CCCTCCACCTCCCCACAGCTCAG 0: 1
1: 0
2: 17
3: 107
4: 781
Right 1163761091 19:19137259-19137281 CCCTCCCTGCACCCAACCACTGG 0: 1
1: 1
2: 14
3: 229
4: 3333
1163761082_1163761096 23 Left 1163761082 19:19137224-19137246 CCCTCCACCTCCCCACAGCTCAG 0: 1
1: 0
2: 17
3: 107
4: 781
Right 1163761096 19:19137270-19137292 CCCAACCACTGGAGTCTCAGAGG 0: 1
1: 0
2: 0
3: 21
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163761082 Original CRISPR CTGAGCTGTGGGGAGGTGGA GGG (reversed) Intronic
901199235 1:7457415-7457437 CTCAGGTGAGGGGAGGTGGGTGG + Intronic
901228925 1:7631201-7631223 GTGAGGTGTGGGGAGCTGGGAGG - Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901637393 1:10676657-10676679 CTGAGCTGTAGGCTGGTCGAGGG - Intronic
901799860 1:11701728-11701750 CCGGGCTGCGGGGAGGCGGAGGG + Intronic
902037034 1:13465343-13465365 CTGAGCTGTGGATGGGTGGGTGG - Intergenic
902234222 1:15047430-15047452 ACGTGCAGTGGGGAGGTGGAGGG + Intronic
902441089 1:16430513-16430535 CTGGGCTCTGGGGAGGGGCATGG + Intronic
902602500 1:17549868-17549890 CAGTGCTGTGGGGTGATGGATGG + Intronic
902746318 1:18476934-18476956 TTGGGGTGTGGGGAGGTGCAAGG - Intergenic
903013068 1:20343959-20343981 CGGGGCTGTGGGGAGATGAAGGG - Intronic
903102771 1:21047458-21047480 CTGAGCTCCTGGGAGGTGGCGGG - Intronic
903477638 1:23630804-23630826 TTGAGCTGGTGGGAGGTGTAGGG + Intronic
903849651 1:26298108-26298130 CTGAGTTGTGGGGGGGAGGGAGG + Intronic
904378548 1:30096457-30096479 CTGAGCTGTGGAGGCATGGAGGG + Intergenic
904704308 1:32378662-32378684 TTGAGGTGTTGGGAGGTGGGAGG - Intronic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
906138770 1:43520641-43520663 AGGAGCAGTGGGGAGCTGGATGG + Intergenic
906148775 1:43575672-43575694 CTCTGCTCTGGGGAGGAGGAGGG - Intronic
906534615 1:46544557-46544579 TGGAGCTGTGGGGCGGGGGAGGG + Intergenic
906821684 1:48936520-48936542 CTGAGCTGTGTGGAGCTGAGGGG - Intronic
906966418 1:50461447-50461469 CTGAGTTGTGGGTAGGTAGATGG - Intronic
908948054 1:69523955-69523977 ATGAGCTCTGGGGAGGTGAGAGG + Intergenic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909317367 1:74240923-74240945 GTGGGGTGTGGGGAGGGGGAGGG - Intronic
910179396 1:84464590-84464612 CAGAGCTTTGGGGTAGTGGAAGG - Intergenic
911178915 1:94843838-94843860 CTTAGCTGTGGAGTGGAGGAGGG + Intronic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
912083320 1:105966923-105966945 GTGAGGTGGGGGGAGGGGGAGGG + Intergenic
912477021 1:109945154-109945176 GTGAGGTGTGGAGAGGTGAAGGG - Intergenic
912530292 1:110315880-110315902 CTGGGGTGTGGGGTGGGGGAGGG + Intergenic
912591358 1:110824295-110824317 CTGTGCTGTGGTGGGGTGGGGGG + Intergenic
912607219 1:111003530-111003552 GGGACCTGTCGGGAGGTGGAGGG + Intergenic
912709673 1:111941419-111941441 CCCAGCTCTGGGGAGCTGGACGG - Intronic
913194489 1:116444444-116444466 CTGAGGTGTGAGGAGGCGGTAGG - Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914676226 1:149909353-149909375 GTGAGCTGAAGGGAGGTGGGAGG - Intronic
915195688 1:154187956-154187978 CTGGGCTTTGGGCAAGTGGATGG - Intronic
915591835 1:156875281-156875303 CTGGGCTCTGTGGGGGTGGAGGG + Intronic
916198391 1:162246783-162246805 CTGTGCTGTGGGGGTGTTGATGG + Intronic
916550421 1:165844662-165844684 CTGACCTCTGGGGAGGTGAGAGG + Intronic
916684572 1:167132794-167132816 TTGGCCTGTGGGGAGGTTGATGG - Intergenic
916720694 1:167482870-167482892 CTAAAATGTGGGGAGGGGGAAGG + Intronic
917731180 1:177876622-177876644 CTGGGCAGTGGGGAGGAGGCTGG + Intergenic
918121652 1:181545991-181546013 CTGAGATGTGGGGAGAGGGTTGG + Intronic
918738054 1:188091919-188091941 GTGAGGTGGGGGGAGGGGGAAGG + Intergenic
918820157 1:189243441-189243463 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
919070678 1:192751445-192751467 CTCAGCTCTTGGGCGGTGGATGG - Intergenic
919691273 1:200530661-200530683 CTGCACTGTGGGGAAGTGGGGGG - Intergenic
920558086 1:206919081-206919103 TTGTGCTGTGGGCAGGAGGAAGG - Intronic
921095788 1:211886274-211886296 CTGTGCTGTGGGGAGGAAGGTGG - Intergenic
921195256 1:212750307-212750329 GTGAGCTGGGAGGAGGTGGGTGG + Intronic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922485487 1:225970119-225970141 CTCAGCTGTTGGGTGGTTGATGG - Intergenic
922577947 1:226675499-226675521 AGGAGCTGTGGGGAGGAGGAAGG + Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923729693 1:236538468-236538490 CTGTGCTTTGGGTAGCTGGATGG + Intronic
923767117 1:236902307-236902329 CTTAGCTTTGGGGTGGTGGGAGG - Exonic
924226481 1:241926400-241926422 GTGACTTGTGGGGATGTGGAGGG - Intergenic
924586504 1:245365515-245365537 CTGAGCTGTAGGCTGGTGGGGGG - Intronic
924676280 1:246181422-246181444 CTCAGCTGTGGGGAGTGGCAGGG - Intronic
924798349 1:247309237-247309259 CTGGGGTGTGGGGAGGTGCTGGG - Intronic
1062811527 10:469989-470011 GTGAGAGGTGGGGAGGTGGATGG + Intronic
1062842486 10:681818-681840 CTGAGCTCTGAAGAGGAGGAAGG - Intronic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063418315 10:5890513-5890535 CCGGGCCGTGGGCAGGTGGAGGG + Intronic
1063455204 10:6178156-6178178 TTGGGCTGTGGGGAGCTGGCGGG + Intronic
1064252669 10:13718663-13718685 CTGAATTGTGGGGAAGAGGAGGG + Intronic
1064282267 10:13961583-13961605 CTGAGGTGGTGGGAGGTGAATGG - Intronic
1064665320 10:17644516-17644538 CAGAGCTGGGAGGAGGTTGAGGG + Intronic
1065144876 10:22758613-22758635 GTGGGCTGTGGGGAGGGGGTGGG + Intergenic
1065293241 10:24251724-24251746 GGGCACTGTGGGGAGGTGGAAGG + Intronic
1065367995 10:24953186-24953208 GGGAGGTGAGGGGAGGTGGAGGG - Intergenic
1065368003 10:24953206-24953228 GGGAGGTGAGGGGAGGTGGAGGG - Intergenic
1066048524 10:31615272-31615294 CTGAGCTCTGGGGAGGTAGTGGG + Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066472324 10:35711241-35711263 GTGGGCTGTGGAGAGGTGGCTGG - Intergenic
1067094451 10:43289827-43289849 CTCACCTGTGAGGAGGTGGATGG + Intergenic
1067097666 10:43313146-43313168 CTCAGCTGTGGGGAACTGCATGG - Intergenic
1067528561 10:47053548-47053570 CTGAGCCATGGGGAGGTGTTGGG + Intergenic
1067549683 10:47225698-47225720 CTGAGCGCTGGGGATGTGGAGGG - Intergenic
1067796973 10:49327722-49327744 CTGACCTTTGGGGATTTGGAGGG + Intergenic
1067820884 10:49529109-49529131 CTGAGTTCTGGTGATGTGGAAGG - Intronic
1069801458 10:71084416-71084438 CTGAGCGGTGGGGAGGGAGAGGG + Intergenic
1069925402 10:71847019-71847041 GGCAGCTGTGGGGAAGTGGAAGG - Intronic
1070435565 10:76389143-76389165 CTGGGCTGTGGGTAGATGGTTGG + Intronic
1070538138 10:77394501-77394523 CGAAGCAGTGGGCAGGTGGATGG + Intronic
1070592587 10:77811414-77811436 CTGAGCTGAGGACAGGTGGAGGG - Intronic
1070724294 10:78777832-78777854 CTGGGACGAGGGGAGGTGGATGG - Intergenic
1070977281 10:80615127-80615149 CTGAGCTGTATGGAGCAGGAAGG + Intronic
1071195612 10:83155631-83155653 CTGAACTGTGGGAATTTGGAAGG + Intergenic
1071557606 10:86617285-86617307 GTGAGGTGGGGGGAGGGGGAGGG - Intergenic
1072253474 10:93600195-93600217 CTGAGGTTTGGGGAGGGGGTAGG + Intronic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073343929 10:102767685-102767707 CAGAGGTTGGGGGAGGTGGAAGG - Intronic
1073449779 10:103602558-103602580 GTGAGGTTTGGGGAGCTGGAGGG - Exonic
1074185797 10:111098615-111098637 CTCAGGTCTGGGGAGGTAGAGGG + Intergenic
1074400327 10:113136262-113136284 CTGAGCTGTGCTGGTGTGGATGG + Intronic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075592642 10:123703644-123703666 CTGAGCTGTGGGCAGAGGGAGGG + Intergenic
1075758374 10:124834794-124834816 CTGCTCTTTGGGGAGGAGGAAGG - Exonic
1076046375 10:127297276-127297298 CTAACCTGTGGGAATGTGGAGGG + Intronic
1076172745 10:128336331-128336353 CTAAGCCGTGGAGAAGTGGAGGG + Intergenic
1076290709 10:129343464-129343486 CTGGGCTGTGTGGAGATAGAGGG - Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1077205526 11:1341331-1341353 GTCAGCTCTGGGGAGGTGAAGGG - Intergenic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077580875 11:3416503-3416525 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1078444021 11:11390650-11390672 CTTGTCAGTGGGGAGGTGGAAGG + Intronic
1078534015 11:12159089-12159111 GTGAGATAAGGGGAGGTGGAGGG - Intronic
1078609800 11:12810312-12810334 CTGAGCTGTTTAGAGGTGTAAGG + Intronic
1079022894 11:16924030-16924052 CTGGGCTCTGGGGAGGTGGGAGG - Intronic
1079164545 11:18027153-18027175 CTTGGCTGTTGGGAGATGGAAGG - Intronic
1079503887 11:21132765-21132787 GTGAGCAGTGGGGTGGGGGAGGG + Intronic
1080123950 11:28709449-28709471 TTCAGAAGTGGGGAGGTGGAGGG - Intergenic
1080542356 11:33280017-33280039 GGGAGCTGAGGGGAGGTGGGGGG + Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081267395 11:41042558-41042580 GAGAGCTTTAGGGAGGTGGAGGG - Intronic
1081617177 11:44597814-44597836 CTGTGCTGTGGGGTGGTTGTGGG + Intronic
1081636725 11:44726877-44726899 CGGAGGTTTGGGGAGGGGGAGGG + Intronic
1082768385 11:57186575-57186597 CTGAGCTGTGCAGAGATCGAGGG + Intronic
1082778957 11:57271318-57271340 CTGGGATGTGGGCAGGTGAATGG - Intergenic
1083419936 11:62546864-62546886 CGGAGCTGTGGGGAGAGGGCGGG + Intronic
1083521625 11:63318974-63318996 GTGGGCTGTGGGGAGGGGGAAGG + Intronic
1083570942 11:63762190-63762212 ATAAGCTGTGAGGTGGTGGAGGG - Exonic
1083642396 11:64152599-64152621 CTGAGGTCTGGGGAGGCTGAGGG + Intronic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083843256 11:65316344-65316366 CAGGGCTGTGGGGAGCTGGGAGG - Intronic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1084209622 11:67615004-67615026 CTGTGATGGGGGGAGCTGGAGGG - Intergenic
1084237802 11:67799337-67799359 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1084569628 11:69951567-69951589 CTGAGCTCTGGGCAGGTCAAGGG + Intergenic
1084834606 11:71793496-71793518 CTGGGCTGTGAGGGGGAGGAGGG - Intronic
1085076540 11:73597492-73597514 CTGAGCTGGGGTGAGGGGCAGGG - Intronic
1085254894 11:75166896-75166918 GTGAGCTGGTGGGAGGAGGAGGG - Intronic
1086098205 11:83071588-83071610 GTGAGCGGTGGGGAGGTGGGGGG - Intronic
1086160495 11:83717045-83717067 ATCAGGAGTGGGGAGGTGGAGGG - Intronic
1086495728 11:87402718-87402740 CTGAGTTGTGGGCAGGTTTATGG + Intergenic
1086874511 11:92078526-92078548 GTGAGGTGGGGGGAGGTGGGAGG + Intergenic
1086932360 11:92706405-92706427 GGGAGCGGTGGGGATGTGGACGG + Intronic
1087138670 11:94744531-94744553 CTGACCTCTGGGGAGGGGAAAGG - Intronic
1087764683 11:102137846-102137868 CTGATTTTTGGAGAGGTGGAAGG + Intronic
1088812922 11:113403603-113403625 CTGAGCAGTGTGGATGTAGAAGG - Intergenic
1088992880 11:114969931-114969953 ATGAGAGGTGGGGAGGGGGAAGG + Intergenic
1089070211 11:115693933-115693955 TACAGCTGTGGGGAGGAGGAGGG - Intergenic
1089190563 11:116650325-116650347 CTGGGCCGTGGGGAGGGTGAGGG - Intergenic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1089377520 11:118005099-118005121 AGGGGATGTGGGGAGGTGGAGGG - Intergenic
1089659883 11:119978871-119978893 CTCAGATGTTGGGAGGAGGAGGG - Intergenic
1089684734 11:120139460-120139482 CTGGGCTGTGTGGAGGGGAATGG + Intronic
1090075799 11:123579315-123579337 CCGTGCTTTGGGGAGGAGGAGGG + Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090658767 11:128865717-128865739 CTGAGCTGTGACAAGGTGCAGGG + Intronic
1091156992 11:133383203-133383225 CTGAGCTGTGGGCAGGACAATGG - Intronic
1091409774 12:231589-231611 TGGGGCTGTGGGGAGGGGGATGG - Intronic
1091597192 12:1886051-1886073 GTGAGTTGAGGGGAGGTGGGGGG + Intronic
1091853687 12:3721845-3721867 CAGGGCTGTGGGGAGGGGAAGGG + Intronic
1092122827 12:6056675-6056697 CTGTCCTGCTGGGAGGTGGAAGG + Intronic
1092408475 12:8236934-8236956 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1093302822 12:17476291-17476313 CTGGGGTGTGGGGAGGGGGGAGG + Intergenic
1093884502 12:24444015-24444037 GTGAGATGTGGGGATGTGGAAGG + Intergenic
1094153338 12:27310792-27310814 CTTTCCTGTGGGGAGGTGGGGGG + Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1095690594 12:45084255-45084277 CTGGGGGGTGGGGTGGTGGAGGG - Intergenic
1095794721 12:46205853-46205875 CTGAGCTGTGGAGGGGAGAAGGG - Intronic
1096199923 12:49674160-49674182 CCGAGCTCTGGAGAGGAGGATGG - Intronic
1096325768 12:50659905-50659927 CAGAGATGTGGGGAGGTGGGTGG - Intronic
1096393696 12:51249170-51249192 GTGAGGTGTGGGGAGGGGGGCGG - Intronic
1096403977 12:51329474-51329496 CTGCTCTGTGGGTATGTGGAGGG + Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1096717326 12:53499392-53499414 CCGAGTTGTGGGGGGGTGGGGGG - Intronic
1097159610 12:57037087-57037109 AAAAGCTGTGGAGAGGTGGAAGG + Exonic
1097177528 12:57152015-57152037 CTGGCCTTTGGGGAGGTGGAAGG + Intronic
1097225802 12:57476229-57476251 GTGGGCTGTGAGGAGGTGGGAGG + Intronic
1097515057 12:60594436-60594458 CTGCGCTGTGGGCGGTTGGAAGG - Intergenic
1097568445 12:61299754-61299776 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1098240840 12:68465273-68465295 CTGAACTGTGGGGAATTGGTGGG + Intergenic
1098358057 12:69629648-69629670 CAAAGCCTTGGGGAGGTGGATGG - Intergenic
1098385132 12:69910392-69910414 TTGGGCAGTCGGGAGGTGGAGGG + Intronic
1098474073 12:70879101-70879123 GTGGGGTGTGGGGAGGGGGAAGG + Intronic
1098925215 12:76342006-76342028 CTGAGCAGGTGGGAGGTGGGTGG + Intergenic
1099303603 12:80927859-80927881 CAGGCCTGTGGGGAGGTGGGGGG - Intronic
1100384306 12:94091553-94091575 CTGAGTGGAGGGGAGGGGGATGG + Intergenic
1100798724 12:98209445-98209467 GTGAGCTGTGGCGAAGGGGATGG + Intergenic
1101036797 12:100715559-100715581 CTGAGGTGTGGGGATGGTGAAGG + Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101804115 12:108048413-108048435 CTGAGGTTTGTGGAGGGGGAGGG + Intergenic
1101902949 12:108804816-108804838 CTGAGCTGCGGGGAGTTGTTTGG - Intronic
1102034944 12:109765737-109765759 CTGATCAGTGGGGAGGTAGCAGG + Intronic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102217712 12:111173324-111173346 TTGATCTGTGGGCTGGTGGATGG + Intronic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1102952711 12:117041012-117041034 CCGAACTGCGGGGAGGGGGATGG + Intronic
1103341912 12:120225259-120225281 CTGAGCCGTGGGGCTGTTGAGGG - Intronic
1103480271 12:121246076-121246098 CAGGGCTGGGGGGAGGTGAATGG + Intronic
1103613460 12:122137890-122137912 CTGTGCTGTGGGGAGGAGGCAGG + Intronic
1104402475 12:128487783-128487805 CTGACCTATGGAGATGTGGAGGG - Intronic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106176776 13:27338528-27338550 GTGGGGTGTGGGGATGTGGAGGG - Intergenic
1106203590 13:27566939-27566961 TTGAGATGAGGGGAGGAGGATGG - Intronic
1106385316 13:29279281-29279303 CTGTGCTGTGGTCAAGTGGAAGG + Intronic
1107454021 13:40537642-40537664 CGGGGCTGTGGGGAGCTGGATGG - Intergenic
1108755494 13:53496433-53496455 GTGAGGTGTGGGGAGGGGGGAGG + Intergenic
1110456663 13:75696841-75696863 CTGAGCCGAGGGGAGGTGTGGGG + Intronic
1112963029 13:105151441-105151463 GTGGGCTGGGGGGAGGGGGAGGG + Intergenic
1113849632 13:113410737-113410759 CTGCGCCGTGGGGATGGGGAGGG + Intergenic
1113931917 13:113973093-113973115 CTGAGCTAAGGGGAGGAGTAAGG + Intergenic
1114665066 14:24372787-24372809 ATGAGCTGAGTGGGGGTGGAAGG - Intronic
1115316831 14:32033627-32033649 CTGTTCTGTGGTGAGCTGGATGG + Intergenic
1116086941 14:40253167-40253189 CTGAGCTGTCTGGAGTTGGGAGG + Intergenic
1116474124 14:45320384-45320406 GTGGGCTGGGGGGAGGGGGAAGG - Intergenic
1116724376 14:48544081-48544103 ATGGGGTGTGGGGAGGGGGATGG - Intergenic
1116809223 14:49523468-49523490 CTGGGCAGTGGGGAGGAGTAGGG - Intergenic
1116972977 14:51087012-51087034 CTGGGGTGGGGGGAGGTGGCGGG + Intronic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117499760 14:56339889-56339911 GAGAGAGGTGGGGAGGTGGAGGG + Intergenic
1117733525 14:58747197-58747219 ATGAGCAGTGGGGAGGTCGTGGG + Intergenic
1117967672 14:61221996-61222018 CTGAGATGGGGGGAAGTAGAAGG + Intronic
1118181404 14:63497013-63497035 TAGAGCTGTGGGCAGGGGGAGGG - Intronic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1118738806 14:68723147-68723169 CTGGGCTGTGGGGAGTGGGACGG - Intronic
1118876275 14:69787472-69787494 TAGGGCTGTGGGGAGGAGGAGGG - Intronic
1119122235 14:72090371-72090393 CTGATCTGACAGGAGGTGGACGG - Intronic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120711633 14:87798702-87798724 CTAAGCTGGGGGCAGGGGGATGG + Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121051362 14:90820886-90820908 ATGAGCTGAAGGAAGGTGGAGGG + Intergenic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1121319984 14:92986647-92986669 CTGAGCTGGAGGGCGCTGGAGGG + Intronic
1122083053 14:99280190-99280212 CTGAGCTGTGAGAAGGTGACAGG + Intergenic
1122935431 14:104953850-104953872 CTGAAGGGTGAGGAGGTGGAAGG - Exonic
1123063374 14:105604547-105604569 CTGAGCTGAGGCGAGCTGGGTGG - Intergenic
1123063675 14:105605771-105605793 GGGAGCTGTGCGGAGGTGGCTGG + Intergenic
1123087434 14:105723333-105723355 CTGAGCTGAGGCGAGCTGGGTGG - Intergenic
1123762886 15:23446540-23446562 CTCCTCTGTGGGGTGGTGGAGGG + Intronic
1123966870 15:25468129-25468151 CTGATCAGTGGTGAGGTGGCTGG + Intergenic
1124118153 15:26866990-26867012 CCGAGCTGGGCGGAGGGGGAGGG - Exonic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125306666 15:38325079-38325101 CAGCACTGTGGGGAGGTGGGTGG - Intronic
1125501526 15:40242716-40242738 CTGAGCTCTGGTGGGGTGGAGGG - Intronic
1126201538 15:45992207-45992229 CAGAGCTGAGGGCAGGGGGAAGG + Intergenic
1126649592 15:50908094-50908116 CTGGGATTTGGGGAGGTGGGCGG - Intergenic
1126734995 15:51722166-51722188 CTGAACTGTGGGGAGTTAGTTGG - Intergenic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127748053 15:62001660-62001682 GTGGGTTGTGGGGAGGGGGAGGG - Intronic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128562164 15:68676031-68676053 CAGGGGTGTGGGCAGGTGGAGGG + Intronic
1128704723 15:69830422-69830444 CTGGGCTGTAGGTAGGTGGCTGG + Intergenic
1128746908 15:70121048-70121070 CAAGGCTGTGGGGAGGTGCATGG + Intergenic
1128977070 15:72161857-72161879 AAGAGCTGCGGGGAGGAGGAGGG + Exonic
1129106028 15:73307904-73307926 ATGAGATTTGGGGAGCTGGAGGG - Intergenic
1129392596 15:75227949-75227971 CTGGGCTGTGCGTAGCTGGAGGG + Intergenic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1130099144 15:80878899-80878921 CTAAGCTCTGGGGCAGTGGAGGG - Intronic
1130162211 15:81413435-81413457 ATAAGCTGAGGGGAGATGGAGGG - Intergenic
1130546169 15:84858556-84858578 GTGAGCAGTGGGGAGGGAGAGGG + Intronic
1130960765 15:88657355-88657377 CTGACCTCTGGGAAGCTGGAGGG + Intergenic
1131441278 15:92461453-92461475 CTGAGCTCTGGGGTCCTGGAAGG - Intronic
1132200679 15:99952632-99952654 ATGGGCTGGGGGCAGGTGGAGGG + Intergenic
1132644372 16:992009-992031 CTGGGCTGTAGGGAGGGGCAAGG + Intergenic
1132654193 16:1035065-1035087 CTGGGGTGTGTGGAGGTGGCTGG + Intergenic
1132689902 16:1177763-1177785 CTCACCTGGTGGGAGGTGGAGGG + Intronic
1132744339 16:1430480-1430502 CTGAGCTCTGGGCAGGTGGGCGG + Intergenic
1132819731 16:1858463-1858485 CCGAGCAGTGGGGAGGAGGTGGG - Intronic
1133349437 16:5091757-5091779 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1133500592 16:6362737-6362759 GTGGCCTGTGGGGAGATGGATGG + Intronic
1134237738 16:12480766-12480788 CTGAGCTCTGAGGAGTGGGAGGG + Intronic
1134248224 16:12555732-12555754 TGGAGTTGTGGGGAGGTGGAAGG - Intronic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1135082246 16:19446083-19446105 AAGAGTTGGGGGGAGGTGGAGGG + Intronic
1135340593 16:21643975-21643997 GTGAGGTGTGGGCAGGTGGAGGG - Intronic
1135658234 16:24270573-24270595 CTGAGCAGTTGGGAGATGGCAGG + Intronic
1135727721 16:24869883-24869905 CCCACCTGTGGGGAGATGGACGG - Exonic
1135895414 16:26396713-26396735 CTGAGCTGTGGGGGTGAAGAAGG - Intergenic
1136022823 16:27450792-27450814 CTGACCTTTGGGGAGGAAGACGG - Exonic
1136065041 16:27753134-27753156 CTTAGATGTGGGGAGGGGGAGGG - Intronic
1136463874 16:30429004-30429026 CTGAGTTGTGGGGGAGGGGAGGG - Intronic
1136654493 16:31701829-31701851 CTGATCTCTGGGAAGGAGGATGG + Intergenic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1137013812 16:35352461-35352483 CCGAGCTATTGGGAGGCGGAGGG - Intergenic
1137020793 16:35425338-35425360 CCGAGCTGTTTGGAGGTGGAGGG - Intergenic
1137027462 16:35492305-35492327 CCGAACTGTTGGGAGGCGGAGGG - Intergenic
1137355315 16:47756866-47756888 ATGAGCAGTGGGGACTTGGAGGG + Intergenic
1137511997 16:49108906-49108928 CCTGGCTGTGGGGAGGAGGAAGG - Intergenic
1137606015 16:49787396-49787418 CTCAGCTATGGGGAGAGGGAGGG - Intronic
1137772512 16:51028023-51028045 TTGAGCTGATGGGAGGAGGAGGG + Intergenic
1138434456 16:56989375-56989397 CGGGGCTGTGGGGAGGTGCCAGG + Intergenic
1139208916 16:65057190-65057212 ATGAGCTGTGGGGAAGATGAAGG - Intronic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1139937663 16:70583016-70583038 ATGAGATGAGGGGAGGTGGTAGG + Intronic
1140266099 16:73422564-73422586 CTGACCTCTGGGAAGTTGGAAGG - Intergenic
1140298172 16:73728969-73728991 CTCAGCTGAGGAGAGGAGGAAGG - Intergenic
1140315338 16:73891026-73891048 CTGAGCGGGGGTGAGGTGGAGGG - Intergenic
1140820835 16:78661639-78661661 CTGAGAGGTGGGGAGGGGGTGGG + Intronic
1141035212 16:80620321-80620343 CTCAGCAGTGGGGAGGTTGATGG - Intronic
1141528574 16:84629640-84629662 GTCTGCGGTGGGGAGGTGGAGGG - Intergenic
1141564133 16:84890017-84890039 CAGGGCTGTTGGGAGGTGAACGG + Intronic
1141614313 16:85202073-85202095 CTGAGCTGGCGGAAGGTGGTGGG + Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141889980 16:86919935-86919957 GTGAGCTGTGGGCTGATGGATGG + Intergenic
1141952263 16:87346665-87346687 TTGAGCTCTGGGCAGGTGGCTGG - Intronic
1142006581 16:87692217-87692239 CAAAGCTGTGGGGAGGGAGACGG - Intronic
1142176621 16:88648218-88648240 CTGTGCTGTGGGGATGGGTAGGG - Intronic
1142231496 16:88902191-88902213 CTGGGCTGGGGGGCGGGGGACGG + Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1142614153 17:1125247-1125269 CTGAGCTGCGGGGACATGGTGGG + Exonic
1142858762 17:2748942-2748964 CTCAGCTTTGCTGAGGTGGAGGG - Intergenic
1142933969 17:3311682-3311704 CTCAGCTGAGGGGAGGAAGAAGG + Intergenic
1142950930 17:3479549-3479571 CAGTGCTGTGGGAAGGTAGAAGG - Intronic
1143100853 17:4503928-4503950 CTGAGCTGGGTGCAGGAGGAGGG + Intronic
1143315219 17:6027124-6027146 CTTACCTGTGGGGAGACGGATGG - Intronic
1143342386 17:6223084-6223106 CTGAGTTGGGGGGAGGGGGGAGG + Intergenic
1143615189 17:8045465-8045487 CTGAGCTGGGGGGAGGCAGGTGG - Exonic
1143731255 17:8884277-8884299 GAGAGCTGTGGGGAGGTGGAGGG - Intronic
1143974721 17:10821305-10821327 GAGAGCTGTGTGGAGGTGGAGGG + Intergenic
1144663577 17:17087221-17087243 CTTAGCTAGGGGGAGGGGGAGGG + Intronic
1144669343 17:17124110-17124132 CAGAGAGGTGGAGAGGTGGAAGG + Intronic
1146762569 17:35491149-35491171 CTGAGCCTCGGGGAGGAGGAAGG + Intronic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147169092 17:38607652-38607674 CTGAGTTGGGGGCAGGTGAAGGG - Intergenic
1147243503 17:39105975-39105997 CAGAGCGTTTGGGAGGTGGACGG - Intronic
1147421454 17:40323965-40323987 CTGAGCTGAGGGGAGGGGTGAGG + Intronic
1147458322 17:40552575-40552597 CTGGGCCGTGGGGAGCTAGAGGG - Intergenic
1147671892 17:42181143-42181165 CTGGCCCGTGGGGAGGTGGGGGG - Exonic
1147862373 17:43531039-43531061 GTGAGCTGGGGAGAGGAGGAGGG - Intronic
1147970374 17:44216284-44216306 CTGAGCTGTGCTGAGATTGACGG - Intronic
1147980808 17:44272844-44272866 CTGAGCAGTCTGGGGGTGGATGG + Intergenic
1148127007 17:45242173-45242195 CGGGGCTGGGGGGAGATGGAGGG + Intronic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148534036 17:48423321-48423343 CTTAGTTGAGGGGAGGTTGAAGG + Intronic
1148774626 17:50088476-50088498 CTGATCTTTGGGGTGGTGGTGGG - Intronic
1149379880 17:56082708-56082730 TTATGCTTTGGGGAGGTGGATGG + Intergenic
1149624073 17:58067200-58067222 CTGAGCCGTGGCTAGGAGGATGG + Intergenic
1150135290 17:62692094-62692116 CTCAGCTGTGGGCAAGAGGAGGG - Exonic
1150569648 17:66374623-66374645 CTGGTCTGTGGGGAGCTGCAGGG + Intronic
1150645865 17:66977081-66977103 CTGAGATGGAGAGAGGTGGAGGG - Intronic
1151294606 17:73175628-73175650 CTGCGTTGGGGGGAGGTGCAGGG + Intergenic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151452956 17:74210546-74210568 CTGGGATGGGGGGAGGTGCATGG + Exonic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1151813575 17:76459585-76459607 TGGAGATGTGGGGAGGTGGGAGG + Intronic
1151909275 17:77071167-77071189 CTCAGCTTTCGGGAGGTGGGAGG - Intergenic
1152241593 17:79164025-79164047 CTGAGCTGTGGGGTGGAGGTGGG - Intronic
1153257043 18:3182284-3182306 ATGAGGTGAGGGGAGGGGGAGGG + Intronic
1153355998 18:4136009-4136031 ATGAGGTGGGGGGAGGGGGAGGG - Intronic
1153446197 18:5175328-5175350 CTGAGTTGTAGGTAGGTGGAAGG + Intronic
1154341514 18:13506361-13506383 CTGGGGTGGGGGGAGGGGGAGGG - Intronic
1154485036 18:14866460-14866482 CTGAGCTGTAGGAGGGTGGCTGG + Intergenic
1155344019 18:24840966-24840988 ATGAGGTGGGGGGAGGTGAAGGG + Intergenic
1155364572 18:25036825-25036847 CTGTGGTGTGGGGAGGTGGCAGG + Intergenic
1155760661 18:29561896-29561918 TGGAGCTGTGGAGAGGAGGATGG - Intergenic
1156545018 18:37955807-37955829 CTGAGCTGTGAGTAGGTAGAGGG - Intergenic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1157762778 18:50276414-50276436 CTGTGCTGTGGGGAGGAAGAGGG + Exonic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1158503168 18:58021953-58021975 CTGAGCTGTGAGGAGCTGCCTGG + Intergenic
1158850596 18:61492498-61492520 GTTAGCTGTGGGGAGGTGTCTGG - Intronic
1160319274 18:77875138-77875160 GAGGGCTGTGGGGAGGTGGAGGG - Intergenic
1160521668 18:79511583-79511605 CTGAGCTGTGGAGGGGTGGAGGG + Intronic
1160555045 18:79719309-79719331 CTGGGATGTGGGCAGGTGCAGGG + Intronic
1160577406 18:79864347-79864369 CTGGGCTGCGGGGAGGTGGGTGG + Intronic
1160699487 19:498914-498936 CTGTGCTGTGGGGCGCTGGGAGG + Intronic
1160808526 19:1002996-1003018 TGGGGCTGGGGGGAGGTGGAGGG + Intronic
1160872764 19:1284641-1284663 CAGAGCTGTGGGACGGTGGTGGG + Intergenic
1160948920 19:1656381-1656403 CAGAGATGGGGTGAGGTGGAAGG + Intergenic
1160971263 19:1768792-1768814 AGGAGGTGTGGGGAGGTGGAAGG + Intronic
1161076577 19:2288663-2288685 CTGGGCTGTGGGGAGGACGGAGG + Intronic
1161173069 19:2823022-2823044 CAGAGCTGTGGGGAGGAAAAAGG - Exonic
1161349109 19:3782784-3782806 CTGGGCTGTGGGGAGGGGAGGGG + Intronic
1161594534 19:5144413-5144435 GTGAGCTGTGGGGTGGGGCAGGG + Intronic
1161622366 19:5304977-5304999 CTGAGCTCTGGGGGGGTAGTGGG - Intronic
1161723073 19:5914377-5914399 CTGGGCTCTGGGCAGCTGGAAGG - Exonic
1161994491 19:7703929-7703951 CTGAGCATTGGAGAGGTGGCTGG - Intergenic
1162967217 19:14161602-14161624 CTGAGGGGTGGGGAAGTGGCTGG + Exonic
1163342963 19:16721618-16721640 GTGAGTTGTGGGAAGGTGGCTGG + Intronic
1163434927 19:17289758-17289780 CTAAGCAGTGGCGAGGTGGGTGG - Intergenic
1163485178 19:17581159-17581181 CGGACCTGGGGGGAGGAGGAGGG - Exonic
1163518077 19:17776732-17776754 CGGAGACATGGGGAGGTGGAGGG - Intronic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1165055957 19:33176542-33176564 CTGAGCTGGGGGAAAGTCGAGGG - Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165391600 19:35542301-35542323 CTTTGCTGTGGGGAAGTGGCAGG - Exonic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165431566 19:35776055-35776077 AGGGGCTGTGGGGAGGAGGAGGG - Intronic
1165736645 19:38181084-38181106 CTGAGCTGGGAAGAGGTGGGGGG + Intronic
1165788695 19:38477875-38477897 CGGGGCTGGGGGGAGGTGGGAGG + Intronic
1165879261 19:39031455-39031477 CTGAGCTGGTGGGAGGGGAAGGG - Intronic
1165903020 19:39177626-39177648 CTGAGCTGTTGGGGGATGGTGGG - Intronic
1166837967 19:45678703-45678725 CTGGGCTGTGGGGAGCAGCAGGG + Intronic
1166853123 19:45769711-45769733 CAGAGCTTTGGGCAGATGGAGGG + Exonic
1166942248 19:46374100-46374122 CTGGGCTGTGGGTGGGTGTAAGG - Intronic
1166959296 19:46488239-46488261 CTTCGCGGTGGGGAGGTGGCGGG + Intronic
1167281606 19:48572543-48572565 CTGACCTGTGTCGAGGTGGAAGG + Intronic
1167396844 19:49235057-49235079 ATGGGCTGTGGGGAGGTGAAGGG + Intergenic
1167411612 19:49347441-49347463 CAGAGCTGTGGGGATGGTGACGG - Intronic
1167435135 19:49474731-49474753 CAGAGATGAGGGGAGATGGACGG + Intronic
1167473633 19:49688352-49688374 CTGGGCTGGGGGGATGGGGAGGG + Exonic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
1167736087 19:51295344-51295366 CTGACCTGTGGGGAGGGGGTGGG - Intergenic
1167959570 19:53095163-53095185 CTGGGCAGTGGGGAGGGGGCGGG - Intronic
1168162982 19:54524664-54524686 ATGAGGTGTGGGGAGAGGGATGG + Intergenic
1168281899 19:55310434-55310456 CTGTGCTGTGGGGAAGGTGAGGG - Intronic
1168327960 19:55547552-55547574 CTGGCCTCTGGGGAGCTGGAAGG + Intergenic
1168345715 19:55649310-55649332 GTGAGCTGAGGGGGTGTGGAGGG + Intronic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1168491032 19:56809035-56809057 CTGGGTTGTGGGGTGGAGGAAGG + Intronic
925077863 2:1033498-1033520 CAGAGCTGTGGAGACGGGGATGG + Intronic
925177582 2:1796323-1796345 GTTAGCAGTGGGGTGGTGGAAGG + Intronic
926006529 2:9377350-9377372 CTGAGCAGTAGGGAGGTAGCAGG + Intronic
926911327 2:17854007-17854029 CTGAGGGGAGGGGAGGCGGAGGG + Intergenic
927183787 2:20467742-20467764 CAGAGCTGGTGGGAGGAGGAAGG + Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928408909 2:31038670-31038692 CAGAGCTGAGGAGAGGTGAATGG + Intronic
928916932 2:36482073-36482095 CTGAGCTCTGTTGAGGTGGAGGG - Intronic
928930719 2:36620841-36620863 AAGATCTGTGGGGAGGTGGCAGG + Intronic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
929549622 2:42881145-42881167 ATGAGCTTTGGAGTGGTGGAAGG + Intergenic
929572604 2:43032127-43032149 CTGTGCTGAGTGGAGGTGGGTGG - Intergenic
930058709 2:47271690-47271712 GTGAGGTGTGGGAAGATGGAGGG + Intergenic
930076389 2:47409066-47409088 CTGAGGGGAGGGGAGGGGGAGGG + Intronic
930167001 2:48212799-48212821 CTGAGTGGTGGGGATGGGGAGGG - Intergenic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
930757795 2:54995436-54995458 CTGAACTGTGTGGTGGTGGTAGG - Intronic
930771932 2:55137900-55137922 TTGCGGTGTGGGGAGGGGGAGGG - Intergenic
931984045 2:67724418-67724440 CTGCGCTTTGGGCAGGTGGCTGG - Intergenic
932144209 2:69304785-69304807 CTGATCTGAGGGTGGGTGGAGGG + Intergenic
932288386 2:70554779-70554801 CTGGAATTTGGGGAGGTGGAGGG + Intergenic
932456395 2:71852450-71852472 CCGAGCTGAGGCGGGGTGGAAGG - Intergenic
932705875 2:74024569-74024591 ATGAGCTGAGGGCTGGTGGAAGG + Intronic
933705388 2:85285718-85285740 CTGCACTGGGGGGAGGTGCAGGG - Intronic
933727597 2:85435558-85435580 CCGAGCAGTGGGGAGCAGGAGGG + Intronic
933943737 2:87266672-87266694 CTGAGCTGAGGGGATGCGGAAGG + Intergenic
934504124 2:94878559-94878581 CTGAGCTGGGGGGAGGTTGTTGG + Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935614151 2:105059353-105059375 TTGAGCTGTATGGACGTGGATGG + Intronic
935834537 2:107036634-107036656 CTGAGCTGACCGGGGGTGGAAGG + Intergenic
935848331 2:107190413-107190435 GTGGGCTGGGGGGAGGGGGAGGG + Intergenic
936175626 2:110217784-110217806 CTGAGCTGTTGGGAATGGGAAGG + Intergenic
936175864 2:110219280-110219302 CTGAGCTGTTGGGAATGGGAAGG + Intergenic
936336483 2:111594907-111594929 CTGAGCTGAGGGGATGCGGAAGG - Intergenic
937501718 2:122486343-122486365 ATGAGGTGTGGGGAGGCTGAGGG + Intergenic
937572883 2:123385451-123385473 GTGTGGTGTGGGGAGGGGGAAGG + Intergenic
937937308 2:127256530-127256552 CCGAGCTGTGGGGATGGGGAGGG + Intergenic
938250601 2:129812933-129812955 CTGAGCAGAGGGGAGGTGAGAGG - Intergenic
938255725 2:129858518-129858540 CTGAGCTTGGGAAAGGTGGACGG - Intergenic
938336844 2:130508682-130508704 CTGGGCTGGGAGGAGGTGGGAGG - Intronic
938352979 2:130611953-130611975 CTGGGCTGGGAGGAGGTGGGAGG + Intronic
938791425 2:134679803-134679825 TTCAGCTGTGGGGTGGTGGTGGG - Intronic
939690483 2:145254243-145254265 TTGATCTATGGGGAGGTGCACGG - Intergenic
940071036 2:149688127-149688149 CTGAACAGTGGCAAGGTGGATGG - Intergenic
940206055 2:151202886-151202908 CTAAAGTGTGGGGAGGTGGGAGG + Intergenic
940416840 2:153432712-153432734 CTGGGGGGTGGGGAGGTGGTTGG + Intergenic
941149237 2:161893252-161893274 GTGTGCGGAGGGGAGGTGGAAGG + Intronic
942173100 2:173306451-173306473 GTGAGGTGTGGGGAGCTGAAGGG + Intergenic
942264723 2:174211164-174211186 GTGTGTTGTGGGGAGGAGGAAGG - Intronic
942545267 2:177056828-177056850 CTGGGCTGTGGGCAGCTGGCAGG - Intergenic
942610016 2:177733724-177733746 TTGAGCTGTGGTGATGTGGAAGG + Intronic
944098264 2:195994317-195994339 CTGAGCCTTGGGGAGGAGGAAGG - Intronic
944766783 2:202872009-202872031 CTGAGGCGTGGGGAAGTGGAAGG + Intergenic
944933560 2:204545283-204545305 CGGAGCTCTGGGGAGTTGTAAGG - Intergenic
945248744 2:207745181-207745203 GGGAGTTGTGGGGAGGGGGATGG + Intronic
945254509 2:207792299-207792321 TTGAGCTGTGGCGGGGTGGGGGG - Intergenic
946464430 2:219898661-219898683 CACAGCAGTGGGGGGGTGGAGGG + Intergenic
947190863 2:227503150-227503172 CTGAGCTTTGGGGAGGTTTTAGG + Intronic
947481464 2:230504239-230504261 GTGACCTGTGGTGAGGTGAAGGG + Exonic
947704337 2:232262218-232262240 CTGGGCCGTTTGGAGGTGGAAGG - Intronic
947745951 2:232507446-232507468 TTGAGATGTGGATAGGTGGATGG - Intergenic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948188011 2:236036383-236036405 CTGGACTGTTGGGAGGTGCATGG + Intronic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948677842 2:239609554-239609576 CTAAGAAGAGGGGAGGTGGATGG - Intergenic
948765580 2:240217093-240217115 GTGAGGGGTGGGGGGGTGGAGGG + Intergenic
948888630 2:240896426-240896448 CTGGGCTGTGGGGAGGAGGGTGG - Intronic
948925529 2:241094339-241094361 CTCAACTGTGGCGATGTGGACGG + Exonic
948928778 2:241117053-241117075 CTGAGCTGTGAGGAGGTGTGAGG + Intronic
1168785743 20:538688-538710 CTGAGCTGGGGTGGGGTGGGAGG + Intronic
1168803719 20:660905-660927 CTGAGTTGAGGGTAGGTGGCAGG + Intronic
1168976389 20:1969268-1969290 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1169012083 20:2259233-2259255 CTGAGGGGTGGGGAGTTAGAGGG + Intergenic
1169028708 20:2391489-2391511 CTGAGCTGTGAGGGGGTGGGGGG + Intronic
1169091959 20:2866350-2866372 CTGAGCTGTGGGCTGGTGAGAGG + Intronic
1170578748 20:17682452-17682474 AGGAGCTGCGGGGAGGTGAAGGG + Intergenic
1170670309 20:18426721-18426743 ATGGGGTGTGGGAAGGTGGAGGG + Intronic
1171188572 20:23141779-23141801 GTGATCTGAGGGGAGGTGGAGGG + Intergenic
1171213883 20:23337675-23337697 CAGAGGTATGGGGAGTTGGAGGG + Intergenic
1171361425 20:24588952-24588974 CTGAGCTGTGGGGTGGGGGTGGG + Intronic
1171370697 20:24660519-24660541 CTGACGAGTGGGGAGGAGGAGGG - Intronic
1171396674 20:24838894-24838916 CTGAGCCCTGGTGAGGTGGATGG + Intergenic
1172143754 20:32742673-32742695 CTTAACTGGGTGGAGGTGGAAGG + Intronic
1172489155 20:35320492-35320514 CTGAGCTGTGGGGCACAGGAAGG - Intronic
1172503934 20:35447195-35447217 GTGAGGTGGGGGGAGGGGGAAGG - Intronic
1172597415 20:36159017-36159039 CTTAACTGTGGGGACTTGGAGGG + Intronic
1172776025 20:37407551-37407573 CAGAGATGTGAAGAGGTGGATGG - Intergenic
1172852071 20:37973696-37973718 CAGAGCTGTGGCGAGGAGGGCGG + Intergenic
1173209522 20:41021393-41021415 CTAGGCTTTGAGGAGGTGGAAGG + Intergenic
1173750286 20:45470574-45470596 CTGGGCTGGGAGGAGGTGGGAGG + Intronic
1174109336 20:48187371-48187393 CTGAGCTGGGGCGAGTTGGCTGG + Intergenic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174183571 20:48690032-48690054 CTGAGCTGTGGGGCGAAGGGAGG + Intronic
1174217342 20:48926831-48926853 CCCAGCTGTGTGGATGTGGATGG - Intronic
1175491571 20:59384007-59384029 GTGAGCGGGGAGGAGGTGGAGGG + Intergenic
1175773928 20:61641349-61641371 GTGGGCTGTGGGGAGCTGGAGGG - Intronic
1175773937 20:61641372-61641394 GTGGGCTGTGGGGAGCTGGAGGG - Intronic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1175788237 20:61725240-61725262 CTGCGGTGTGTGCAGGTGGACGG - Intronic
1175959080 20:62626023-62626045 CTGAGGTGTCTGGAGCTGGAGGG - Intergenic
1176064611 20:63188104-63188126 ATCAGCCCTGGGGAGGTGGAAGG + Intergenic
1176310478 21:5146425-5146447 CTGAGCTGGAGGGAGGTGCCGGG - Intronic
1176410679 21:6447971-6447993 CTGGCCTGTGGGGATGTGGTGGG + Intergenic
1176796292 21:13373015-13373037 CTGAGCTGTAGGAGGGTGGCTGG - Intergenic
1178903356 21:36615470-36615492 ATGAGCTGTGGGGGTGTGGCTGG - Intergenic
1179083610 21:38196306-38196328 CTGAGCTGTGGGCAGGGATAAGG - Intronic
1179167339 21:38945108-38945130 CAGAGCTGGGCGGAGGAGGATGG - Intergenic
1179627622 21:42657605-42657627 CTCAGCACTGGGGAGCTGGAGGG + Intronic
1179686173 21:43056293-43056315 CTGGCCTGTGGGGATGTGGTGGG + Intronic
1179846577 21:44115610-44115632 CTGAGCTGGAGGGAGGTGCCGGG + Intronic
1180075474 21:45459442-45459464 CTGAGGGGAGGGGAGCTGGAGGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1181267516 22:21639400-21639422 ATCAGCTGTGGAGAGGAGGAAGG - Intergenic
1181468952 22:23126436-23126458 TTGAGCTGTGAGGATGGGGAAGG - Intronic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1182274403 22:29177082-29177104 CTGAGCTGGGGGGACGGGGAAGG + Intergenic
1183408144 22:37640330-37640352 CTGGGCTGGGGGGAGGGGGAGGG - Intronic
1183786001 22:40029562-40029584 CTGAGCTGCGGGATGGTGGTGGG + Exonic
1183856267 22:40636950-40636972 CTGAGCTGCGGCGAGGGGGTTGG + Intergenic
1184569251 22:45311431-45311453 CTGAGCTGAAGGAAGGTGGGAGG + Intronic
1184828614 22:46970067-46970089 CTGGGCTGTGGGGAGGGCGAGGG - Intronic
1184998663 22:48228378-48228400 CTGGGCTGTGGGGAGGTCTGAGG + Intergenic
1185047256 22:48534665-48534687 CGGGGGTGTGGGGAGGTTGAAGG + Intronic
1185052178 22:48559678-48559700 CTGAGCCTTGAGGAGGAGGAAGG + Intronic
1185162609 22:49238909-49238931 TGGAGCGGTGGGGAGTTGGACGG - Intergenic
1185272057 22:49934342-49934364 CTGAGCTGTGAGGAGGGGGCTGG + Intergenic
1185330263 22:50249194-50249216 CTGAACTGTGGGGCAGGGGAGGG + Intronic
1185336808 22:50274654-50274676 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185336868 22:50274780-50274802 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185336913 22:50274874-50274896 GGGAGCTGTGGGGAGGTGGAGGG - Intergenic
1185393655 22:50576108-50576130 CTCACCTGTGGGGAGGTGGAAGG + Exonic
949152466 3:786555-786577 GTGAGGTGTTGGGAGTTGGAAGG + Intergenic
949719110 3:6967882-6967904 CTGGGGTGTGGAGAGGAGGAGGG + Intronic
950630608 3:14279419-14279441 GTAAGTAGTGGGGAGGTGGAAGG + Intergenic
950713386 3:14829807-14829829 CTGACAGGTGGGGAGGAGGAAGG - Intronic
952651248 3:35729352-35729374 GTGTGCTCTGGAGAGGTGGATGG - Exonic
952743536 3:36757227-36757249 CTGCACTTTGGGGAAGTGGAGGG - Intergenic
952751302 3:36827108-36827130 CTGAGCTGAGGGGTGGGGTAAGG + Exonic
953371057 3:42388880-42388902 GTGAGTTGTGGGGAGGAGGTAGG + Intergenic
953412644 3:42698898-42698920 CGGAGCTGTGGGCAGGGAGAAGG + Exonic
953681990 3:45046305-45046327 CAGAGCTGGGTGGAGGTGGATGG + Intergenic
953699251 3:45183356-45183378 CAGAGCTGGGTGGAGGTGGATGG + Intergenic
954326790 3:49868424-49868446 CTGAGGCATGGGGAGGTGAAGGG - Intronic
954376209 3:50195375-50195397 CAGAGCTTTGGTGAGGTGGCAGG - Exonic
954417939 3:50403191-50403213 CAGGGCTGTGAGGATGTGGATGG + Intronic
954452747 3:50580456-50580478 CTGACCAGAGGGGAGGTGGATGG + Exonic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954687182 3:52377301-52377323 GTGAGCTGTGGGGTGAGGGAAGG - Intronic
954708542 3:52493833-52493855 CAGGGCTGTGGAGAGGTGGGTGG + Intergenic
954762560 3:52887270-52887292 GTGAGATCTTGGGAGGTGGAAGG - Intronic
955316591 3:57944198-57944220 CAGAGCAGTGGGGGGCTGGAAGG - Intergenic
955390394 3:58518389-58518411 CTGGGCTGTGGAGAGAAGGAGGG - Intronic
956456873 3:69430259-69430281 CTGGATTGTGGGGAGGTGGCTGG - Intronic
957007205 3:74963581-74963603 CTGTGCTTTAGGGAGCTGGATGG - Intergenic
957053745 3:75429099-75429121 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
957457617 3:80472674-80472696 CTGGGAGGTGGGGAGGTGGCTGG - Intergenic
957801982 3:85097141-85097163 GTGGGGTGTGGGGAGGGGGAAGG - Intronic
957885549 3:86282580-86282602 CTCAGCCGTTGGGTGGTGGATGG - Intergenic
958410231 3:93807163-93807185 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
958896575 3:99836312-99836334 CTGAGCAGTGGGGAAGGTGATGG + Intronic
959108812 3:102097152-102097174 CTGGGCTGGGGTGAGGGGGAGGG + Intergenic
960450189 3:117797409-117797431 TTGAGCTGAGAGGAGGTTGAGGG + Intergenic
960556741 3:119038408-119038430 TTGGGCTATGGGGAGGAGGATGG - Intronic
960941858 3:122940103-122940125 CTGGACTGTGGGGAGAGGGATGG - Intronic
961301100 3:125922580-125922602 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
961393473 3:126570299-126570321 CTGGGGTGAGGGGAGCTGGAAGG + Intergenic
961404049 3:126666498-126666520 CTGAGGTGTGGGAAGGTGACAGG - Intergenic
961433085 3:126897037-126897059 ATGAGGTGTGGAGAGTTGGATGG + Intronic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
961887425 3:130105493-130105515 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
962165076 3:133039347-133039369 CTGGGTTGTGGGGAGAGGGAAGG + Intronic
962298989 3:134220409-134220431 CTGACGTATGGGGAGGGGGAGGG + Intronic
962574641 3:136745592-136745614 CTGATCTGACAGGAGGTGGATGG + Intronic
962841917 3:139241317-139241339 CTGCGGGGTGGGGAGGGGGAAGG - Intronic
962849473 3:139297309-139297331 ATGAGGTGAGGGGAGATGGAGGG - Intronic
963101088 3:141604755-141604777 CTGGGGTGTGGGGAGGGGGGAGG + Intronic
963947010 3:151156746-151156768 CAGAGCTGAGGGGAGGGGTAAGG + Intronic
964043720 3:152296366-152296388 CTTAACTGTGGGCAGGAGGAGGG + Intronic
964068872 3:152608190-152608212 GTGAGATGTGGGGAGGTAAAAGG + Intergenic
964110781 3:153085204-153085226 CTGAGGTGGGAGGAGGTGGGAGG - Intergenic
964422975 3:156523960-156523982 CTAAGCTATGGGGTGGTAGAGGG + Intronic
964514607 3:157494358-157494380 CTGAGCTGGGAGGATGTGGGTGG + Intronic
964518801 3:157542169-157542191 CAGCGCTGTGGGGAGGAGTATGG - Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966234306 3:177683755-177683777 CTGCCCTGTGTGGTGGTGGATGG + Intergenic
967269899 3:187724892-187724914 CTGACCTGCGGGGATGTGGAGGG - Intronic
967602753 3:191409073-191409095 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
967633877 3:191778289-191778311 CTGAGATGTGGGGTGGGGGTTGG + Intergenic
967873663 3:194251926-194251948 GGGTGCTGTGGGGAGGGGGAGGG + Intergenic
968589499 4:1450333-1450355 CTGAGCTCTGGGAAAGGGGAGGG + Intergenic
968598086 4:1495670-1495692 CTGACCTCGGGGGCGGTGGAGGG - Intergenic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968628340 4:1637917-1637939 CAGAGCCGTGGACAGGTGGATGG - Intronic
968921906 4:3526744-3526766 CTGAGCTGCAGGGAGCAGGATGG - Intronic
968936575 4:3614243-3614265 CTGGGCTGCAGGGAGGTGGGAGG - Intergenic
968983117 4:3861321-3861343 CTCTGCTGTGTGGGGGTGGAGGG + Intergenic
968996549 4:3949411-3949433 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
969258716 4:6020718-6020740 CTGAGCTCTGGGGCGGTGGTGGG + Intergenic
969287895 4:6218117-6218139 CTGAGCTGAGGAGAGGTAGAAGG - Intergenic
969445975 4:7244942-7244964 CTGAGAAGTGGGCAGTTGGAAGG + Intronic
969471856 4:7393842-7393864 CTGAGCTGTGTTGAGGTCGACGG + Intronic
969643683 4:8413636-8413658 CAGTGCTGTGGAGGGGTGGAGGG - Intronic
969719964 4:8888205-8888227 CTGTGGGGTGCGGAGGTGGAGGG - Intergenic
969757451 4:9159271-9159293 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969817411 4:9696807-9696829 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969886360 4:10218988-10219010 CTGGGCTGTGGGGTGGTGAGTGG - Intergenic
970320209 4:14867904-14867926 CAGGGCTGTGGGGAGGGGGCGGG - Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
971987036 4:33839326-33839348 CAGAGCCTTGGGGTGGTGGAAGG + Intergenic
972621322 4:40750329-40750351 CTGGGCTGTGGGGACGCGGACGG + Intronic
972622592 4:40762966-40762988 ATGAACTGGGGGAAGGTGGAGGG - Intronic
972900186 4:43672713-43672735 CTCAGCTCTTGGGTGGTGGATGG - Intergenic
973677970 4:53285933-53285955 CGGGGTTGTGGGGAGGTGGTGGG - Intronic
973833499 4:54786015-54786037 CTGAGCTGGGGGGAGTAGGTTGG - Intergenic
974521532 4:62987186-62987208 CTGTGCTGTGGGCAGTGGGAAGG - Intergenic
975190390 4:71453715-71453737 CTGAGCTGTAGGGGTGAGGAAGG - Intronic
976444217 4:85111228-85111250 CTGAGCTGCCTGGAGGTGAAGGG - Intergenic
976465273 4:85360806-85360828 CTGAGCAGGGTGGTGGTGGAAGG + Intergenic
977396968 4:96483642-96483664 CTGAGCTGCCTGGAGGTGGTTGG + Intergenic
978210095 4:106124850-106124872 GTGGGCTGGGGGGAGGGGGAAGG + Intronic
978254823 4:106681453-106681475 CTTAGCTCTTGGGCGGTGGATGG + Intergenic
978728740 4:112000013-112000035 CTGAGGTGTGGTGAGCTGGGCGG + Intergenic
979137294 4:117125577-117125599 CTGAGGTCTGGGGGAGTGGATGG - Intergenic
979600806 4:122584880-122584902 TTGAGATGTGTGGAGGAGGATGG + Intergenic
981444458 4:144819601-144819623 CTAATCTGTGGAGAGGAGGATGG - Intergenic
982085346 4:151829913-151829935 CTCAGTTGTGGGGAGGTGGTAGG + Intergenic
982564440 4:156971162-156971184 CTGAGCTGTGGCGAAGTGGTGGG + Exonic
983695668 4:170526823-170526845 ATGAGCTGGGAGGAGGGGGAAGG + Intergenic
983759151 4:171384248-171384270 CTCAGCAGGAGGGAGGTGGATGG - Intergenic
984126088 4:175812671-175812693 CTGAGCTGTGAACAGATGGAGGG + Intronic
984713282 4:182903683-182903705 CTGGGCTGTGGGCAGGCGGATGG - Intronic
984769083 4:183422147-183422169 CTGAGGTGCTGGGAGGTAGACGG - Intergenic
985627158 5:995055-995077 GAAGGCTGTGGGGAGGTGGAAGG - Intergenic
987061387 5:14247070-14247092 CTGAGCTGTGGGGAAGGGGGAGG - Intronic
987085359 5:14462815-14462837 CAGAGCTGTGGAGAAGAGGAAGG + Exonic
987524561 5:19030781-19030803 CTGAGTTGTGAGGAGGAAGAAGG - Intergenic
988152292 5:27399809-27399831 CTGGGATGGGGGGAGGGGGAAGG + Intergenic
988635661 5:32981388-32981410 CAGAGCTGAGGAGAGGAGGATGG - Intergenic
988891143 5:35618234-35618256 GTGAGCTGTAGGGAGGTGGCGGG - Intronic
989180216 5:38568946-38568968 CTGAGCTGTGGTGAGAGGTAGGG + Intronic
989204325 5:38796557-38796579 CTGAGCTGAGGGTGGGTGGGTGG + Intergenic
990627453 5:57630714-57630736 GTGAGGTGGGGGGAGGGGGAAGG - Intergenic
991447737 5:66717942-66717964 AACAGCTGTGGGGAGGTGGTAGG - Intronic
992210056 5:74469926-74469948 CTTAGCAGAGGGGAGATGGATGG - Intergenic
995202462 5:109441757-109441779 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
995552387 5:113294241-113294263 TAGGGCTGTGGGGAGGTCGAGGG + Intronic
996253952 5:121374810-121374832 GTGAGGTGGGGGGAGGGGGAAGG + Intergenic
996351024 5:122542062-122542084 CTGAGTTGCAGGGAGGGGGAAGG - Intergenic
996536238 5:124581000-124581022 CTGAGCTTTGGGGAAGGGGAGGG - Intergenic
996586041 5:125089010-125089032 CTCAGCCGTTGGGTGGTGGATGG - Intergenic
997305631 5:132833875-132833897 CTGATAGGTGGGGAGGTGGTGGG + Intergenic
997351104 5:133232049-133232071 CTGAACTGTGGGGAGGTCAAGGG + Intronic
998003280 5:138640893-138640915 CTGAGGGGTGGGGAGGTGTGAGG + Intronic
999295003 5:150453745-150453767 CAGAGCTGTGAGGTGGTGAAGGG + Intergenic
999295775 5:150458778-150458800 CTGTGCTGAGGGGAGGGGGTGGG + Intergenic
999437127 5:151571516-151571538 ATGAGCTGTAGGGAAGGGGAAGG + Intergenic
999758553 5:154682951-154682973 CGGAGCTGGAGGGAGGCGGAGGG - Intergenic
1000478718 5:161744614-161744636 ATGAGCTGTGGGGAGGTTAGGGG + Intergenic
1000509609 5:162165104-162165126 CTGTGCTGTGCAGAGGTGGTGGG - Intergenic
1000715914 5:164644061-164644083 GTGTGGTGTGGAGAGGTGGAGGG + Intergenic
1001111254 5:168897990-168898012 CTGAGCTGAGGGGGACTGGAAGG - Intronic
1001150063 5:169219572-169219594 CTGAGCTGTGCAGAGGTGGCAGG + Intronic
1001258382 5:170203205-170203227 TAGAGCTGTGGAGAGGAGGAAGG + Intergenic
1001350977 5:170964539-170964561 GTGGGGTGGGGGGAGGTGGAAGG - Intronic
1001953413 5:175831689-175831711 CTGAGCTGTGGGTATCTTGAGGG - Intronic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1002105031 5:176875818-176875840 CTGAGCTGGTGGGAGGGGCAGGG - Intronic
1002154400 5:177265436-177265458 CTGGGCTGGGGGGATGGGGAGGG - Intronic
1002189863 5:177472843-177472865 CTGGGCTGGAGTGAGGTGGAAGG - Exonic
1002197881 5:177511043-177511065 CTGAGCTGTGAGGACCTAGATGG - Intronic
1002293066 5:178212754-178212776 CTGGGCTGTCAGGAGGTGGAAGG - Intronic
1002302733 5:178266724-178266746 CTGAGCTGTGAGCAGGAGCAGGG - Intronic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1003020403 6:2504728-2504750 CTGAGAAGTGGGGAGGGGTAAGG - Intergenic
1003048895 6:2763342-2763364 CTCAGCTCTGGGGTGGTGAACGG + Intergenic
1003263553 6:4546801-4546823 CTGAGCTGTGTGGACTTGGAGGG + Intergenic
1003505453 6:6736826-6736848 CGGAGCTGTGGGGACGCGGGTGG - Intergenic
1003612945 6:7629870-7629892 CTGAGCTGTGGGCAGAGGCAAGG - Intergenic
1003645262 6:7909681-7909703 CTGAGCTGCAGGGGGGCGGAGGG + Intronic
1004014837 6:11722892-11722914 CTGAGTTGGGAGGAGGTGGGAGG + Intronic
1004017392 6:11744580-11744602 CTGAGATGGGGCCAGGTGGAAGG + Intronic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1004317176 6:14599732-14599754 AGGAGAGGTGGGGAGGTGGAGGG + Intergenic
1004861331 6:19807015-19807037 CTCAGCCGTTGGGTGGTGGATGG + Intergenic
1004934050 6:20490338-20490360 CTGAGCCTCGGGGAGGAGGAAGG + Exonic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1006278816 6:33029724-33029746 CAGGGCTGTGAGGAGGGGGATGG - Intergenic
1006387607 6:33740130-33740152 CTGAGCTGTAGGGATGTGGGAGG - Intronic
1006604284 6:35244934-35244956 GTGAGTTGGGGAGAGGTGGAAGG - Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984159 6:38166555-38166577 CTCTGCTGTGCGGAGGGGGAAGG - Intergenic
1007161292 6:39793346-39793368 CTGAGCTGTGGGGTGGAGGAAGG + Intronic
1007254458 6:40518983-40519005 CTGAGCAGTGGGGAGAGAGAGGG + Intronic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1008037562 6:46761924-46761946 GTGAGGTGGGGGGAGGGGGAAGG - Intergenic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1009273895 6:61650220-61650242 ATGAGAGGTGGGGAGGTTGAGGG - Intergenic
1011172498 6:84521705-84521727 CTTAGCTGGGGGGAGGTGAAAGG + Intergenic
1012388899 6:98714564-98714586 CTGAGATTTGGAGAGGTGAAGGG - Intergenic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013079762 6:106801919-106801941 CACAGCTGGGGGGAAGTGGAGGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014760074 6:125346393-125346415 CGGAGCTGGGGGGAGAAGGAAGG + Intergenic
1014826814 6:126056373-126056395 CTGAGATGTGGGGAGGTTATTGG + Intergenic
1015562341 6:134530116-134530138 CTGTGATGTGGGTAGGTTGATGG - Intergenic
1016154504 6:140786976-140786998 GTGAGCATTGGGGATGTGGATGG - Intergenic
1016461497 6:144284637-144284659 CTGAGATGGGGTGAGTTGGAAGG + Intergenic
1016472594 6:144390219-144390241 CTGGGACGTGGTGAGGTGGATGG - Intronic
1017405811 6:154117003-154117025 CTCATCTGTGGGGTGGAGGATGG - Intronic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1018231945 6:161683504-161683526 CTGAGCTGAGGGGAGAGGAAAGG - Intronic
1018908902 6:168090692-168090714 CTCAGCAGTGGGGAGATGGAAGG - Intergenic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019276119 7:176879-176901 CTGAGGTGCAGGGAGGTGGGAGG + Intergenic
1019496384 7:1342345-1342367 CTGATGTGTGGGGAGGGGCATGG + Intergenic
1019566846 7:1687116-1687138 CTGAGTTGGGGGGAGGTGCGGGG + Intergenic
1019838004 7:3409762-3409784 GTGGGCTGTGGTGGGGTGGAGGG + Intronic
1019941836 7:4298079-4298101 CTGAGCTGGTGGGAGGTGGCAGG + Intergenic
1020154710 7:5713229-5713251 CTGAGTGGTGGGGAGGGGCAGGG + Intronic
1020158824 7:5751725-5751747 CTGAGCTGAGGAGAAGTGGTTGG - Intronic
1020320830 7:6937826-6937848 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1020441100 7:8217372-8217394 GTTAGCTGTGTAGAGGTGGAGGG - Intronic
1022388584 7:29924397-29924419 CTGAGGAGTGGGGAGATGCAGGG - Intronic
1022389227 7:29928955-29928977 TGGAGCAGTGGGGAGGAGGAGGG + Intronic
1023634769 7:42198495-42198517 CTGAGCTCCGGGGATGTGGGAGG + Intronic
1023710183 7:42984164-42984186 CTGATCTGTGGGCAGCTGAATGG + Intergenic
1023759838 7:43455053-43455075 CTGAGCTGGGGTGAGGTGGGTGG - Intronic
1024357437 7:48428471-48428493 CTGAGCTCTAGGGATGTGGAGGG + Intronic
1024457724 7:49628125-49628147 CTAAAGTGTGGGGAGGTGAAGGG + Intergenic
1024672874 7:51612552-51612574 CTGAGGTGGGGGTAGGTGGGAGG + Intergenic
1026534420 7:71228333-71228355 CTGAGCTGAGTGGAGGTGGACGG - Intronic
1026544608 7:71311108-71311130 CTGAGCTGCAGGAAGCTGGAAGG + Intronic
1026737401 7:72957717-72957739 CAGGGCTGTGGGGAGGCTGAGGG + Intergenic
1026767704 7:73171045-73171067 CTGAGCTGTGGGGATGCGGGAGG + Intergenic
1027044170 7:74980753-74980775 CTGAGCTGTGGGGATGCGGGAGG + Intronic
1027079472 7:75221605-75221627 CTGAGCTGTGGGGATGCGGGAGG - Intergenic
1027106331 7:75407351-75407373 CAGGGCTGTGGGGAGGCTGAGGG - Intronic
1027187611 7:75981414-75981436 CTGAGCTTTGGGGATGGGGTGGG + Intronic
1027267910 7:76504211-76504233 CTGAGCTGTGGAGAAGTGGAGGG - Intronic
1027319721 7:77004073-77004095 CTGAGCTGTGGAGAAGTGGAGGG - Intergenic
1028746040 7:94327789-94327811 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
1029388692 7:100260187-100260209 CTGAGCTGTGGGGATGCGGGAGG - Intronic
1029452675 7:100649955-100649977 CTCAGCTGTGATGAGCTGGAGGG - Intronic
1029683897 7:102132119-102132141 CAGAGCTTTGTGGAGATGGATGG + Intronic
1029871451 7:103697263-103697285 ATGAATTCTGGGGAGGTGGAGGG + Intronic
1030178900 7:106684525-106684547 GTGGGTTGTGGGGAGGGGGAGGG - Intergenic
1031427333 7:121621473-121621495 CTTTGCTGTGGGGAAGTGGGAGG + Intergenic
1031999185 7:128253875-128253897 CAGTGCTGTGGGCAGATGGATGG + Intronic
1032116392 7:129121337-129121359 CTGCCCAGTGGGGAGGTGAAAGG - Intergenic
1032785951 7:135199512-135199534 CTAAGATCTGGGGAGGTGGTAGG + Intronic
1033273637 7:139955297-139955319 CAGATCTGGGGGGAGGTGGAGGG - Intronic
1033786047 7:144731800-144731822 CTGAGCTGTGTCCAGGTCGATGG - Intronic
1034154166 7:148940968-148940990 CTGGGCTCTGGGGAGGGAGAGGG - Intergenic
1034392981 7:150800620-150800642 CTGGGCTCTGGGGAGCTGGGAGG - Exonic
1035075850 7:156176821-156176843 CAGAGCTGTGGCCAGGAGGAGGG + Intergenic
1035140419 7:156753741-156753763 GTGTGCTGTGGGGAAGGGGAAGG + Intronic
1035294801 7:157861013-157861035 GGGAGCTGTGGAGAGGTGGGGGG + Intronic
1035773605 8:2170214-2170236 AGGGGCTGTGGGGAGGTGGCTGG + Intergenic
1036229003 8:6983730-6983752 CTGAGGAGCTGGGAGGTGGAGGG - Intergenic
1036231456 8:7002835-7002857 CTGAGGAGCTGGGAGGTGGAGGG - Intronic
1036233913 8:7021929-7021951 CTGAGGAGCTGGGAGGTGGAGGG - Intergenic
1036380694 8:8234599-8234621 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
1036848880 8:12188035-12188057 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1036870241 8:12430313-12430335 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1036898738 8:12656209-12656231 TGGGGATGTGGGGAGGTGGAGGG - Intergenic
1037614069 8:20501624-20501646 CTGATTAGTGGGGAGGTGAATGG - Intergenic
1037709453 8:21343937-21343959 CTGAGGTGTGGGGGAGAGGAAGG - Intergenic
1037796860 8:22002945-22002967 CTGAGTTGTGGGGAATGGGATGG - Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038745889 8:30254387-30254409 CTGATCTGACAGGAGGTGGATGG + Intergenic
1038946446 8:32366344-32366366 CTGAGATGGGTGGAGGTGGGGGG - Intronic
1040480245 8:47819043-47819065 CTGAGCAGTGGGGAAGAGGCAGG - Intronic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041686919 8:60652537-60652559 CTAAGCTGTGCGGAAGTGAAAGG + Intergenic
1042185777 8:66135186-66135208 CTAAGGTGTGGGGATGGGGAGGG - Intronic
1042865889 8:73356606-73356628 ATGAGCTGGAGGGAGGAGGAGGG - Intergenic
1043303694 8:78767912-78767934 GTGAGGTGGGGGGAGGGGGAGGG - Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044509713 8:93060310-93060332 GTCAGCTGTGGGGAGGGTGAGGG - Intergenic
1045108716 8:98919305-98919327 CTGATTTGTGGGTAGGTGAATGG - Intronic
1045488376 8:102651879-102651901 CTGAGCTTTGGGGAGTTTGGGGG + Exonic
1045880144 8:107029035-107029057 CTGAGATGTGGGTTGGTGTATGG - Intergenic
1046418560 8:113948093-113948115 CTGGGTTGTGGGGAACTGGAAGG - Intergenic
1046469562 8:114653174-114653196 GTGGGCTGGGGGGAGGGGGAAGG - Intergenic
1047621006 8:126608002-126608024 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
1047707156 8:127511242-127511264 ATGAGGTGGGGGGAGGGGGAGGG - Intergenic
1048802363 8:138206217-138206239 GAGAGCTGTGTGTAGGTGGAGGG - Intronic
1048802368 8:138206245-138206267 TAGAGCTGTGTGTAGGTGGAGGG - Intronic
1048802373 8:138206273-138206295 TAGAGCTGTGCGTAGGTGGAGGG - Intronic
1048802378 8:138206301-138206323 TAGAGCTGTGGGTAGGTGGAGGG - Intronic
1048802385 8:138206329-138206351 TGGAGTTGTGGGTAGGTGGAGGG - Intronic
1048802393 8:138206357-138206379 TAGAGTTGTGGGTAGGTGGAGGG - Intronic
1048802400 8:138206385-138206407 TAGAGCTGTGTGTAGGTGGAGGG - Intronic
1048802405 8:138206413-138206435 TAGAGCTGTGTGTAGGTGGAGGG - Intronic
1048802415 8:138206469-138206491 TAGAGCTGTGTGTAGGTGGAGGG - Intronic
1048802420 8:138206497-138206519 TAGAGCTGTGGGTAGGTCGAGGG - Intronic
1048802487 8:138206861-138206883 TAGAGCTGTGGGTAGGTGGAGGG - Intronic
1048802509 8:138206945-138206967 TGGAGTTGTGGGTAGGTGGAGGG - Intronic
1049168731 8:141144388-141144410 GTCAGCTGTGGGGAGGCGGGGGG - Intronic
1049325706 8:142020384-142020406 GGGAGCTGTGGGGAGGTGAGGGG + Intergenic
1049341162 8:142113346-142113368 CTGAGCTGGGGAGAGGAGAAGGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049426467 8:142540110-142540132 CTGAGCTGTGGAGAGGCCAATGG + Intronic
1051018841 9:12515697-12515719 GTGAGGTGGGGGGAGGGGGAGGG + Intergenic
1051199175 9:14597920-14597942 CTCAGTTGTGTGGAGGGGGAGGG - Intergenic
1051235887 9:14998263-14998285 GTGGGGTGTGGGGAGGGGGAAGG + Intergenic
1052054868 9:23894032-23894054 GTGAGGTGGGGGGAGGGGGAAGG - Intergenic
1052844396 9:33322334-33322356 CTGAGCTGAGGGGAGGAGGAAGG - Intronic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1053870514 9:42487052-42487074 CTGAGCAGTGGAGAGATGGAAGG + Intergenic
1054085771 9:60742075-60742097 CTGAGCAGTAGAGAGATGGAAGG - Intergenic
1054241032 9:62613312-62613334 CTGAGCAGTGGAGAGATGGAAGG - Intergenic
1054817707 9:69491454-69491476 ATGGGGTGGGGGGAGGTGGAGGG + Intronic
1055238801 9:74158541-74158563 CTGAGGAGTGAGGACGTGGAGGG + Intergenic
1055451730 9:76436957-76436979 GTGGGGTGTGGGGAGGGGGAAGG + Intronic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1056230462 9:84538303-84538325 CTGAGCTGCCTGGAGCTGGAGGG + Intergenic
1056419427 9:86409384-86409406 CTCAGCTTTGTGGAGGTGGAAGG + Intergenic
1056682696 9:88732970-88732992 CTAAGCAGTGGTGAGATGGAAGG + Intergenic
1056989745 9:91399713-91399735 GTGGGCTTTGGGGAGGTGGTCGG + Intergenic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057301920 9:93891477-93891499 CTGGGGTGAGGGCAGGTGGATGG + Intergenic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057690296 9:97277887-97277909 CAGAGCTGAGGGGAGATTGAGGG - Intergenic
1057828812 9:98391811-98391833 CTGAGCAGTGGGGACGTGCGGGG + Intronic
1057884744 9:98821798-98821820 CAGAGGAGTGGGGAGGGGGAAGG - Intronic
1057928252 9:99171353-99171375 CTGTGCTGTGGGGAGGATGCAGG - Intergenic
1058765822 9:108181704-108181726 GGGAGCTGTGGGGAGTTGTAGGG + Intergenic
1059333031 9:113548529-113548551 CAGAGCTGAGGGGAAGAGGAGGG + Intronic
1059958653 9:119544135-119544157 CTGAGATGTGGGGAGGGGAAGGG + Intergenic
1059964772 9:119602803-119602825 CTGTGGTGTAGGGAGTTGGAGGG - Intergenic
1060294428 9:122333550-122333572 CTACGATGTGGGGAGGTGGGAGG + Intergenic
1060350230 9:122852614-122852636 CTGACCGGGAGGGAGGTGGAGGG + Intronic
1060531976 9:124353048-124353070 CAGAGCTGTGTGAAGGTGGGTGG - Exonic
1060881841 9:127122927-127122949 CTGAGCTTTGGGGAGAGGGCGGG - Intronic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1061448496 9:130655753-130655775 CTGAGCTATGGAGAGGGGAAGGG + Intergenic
1061954787 9:133955816-133955838 CAGAGCTGTGGGGAGGAGTGGGG - Intronic
1062042719 9:134411495-134411517 GTGAGCCGTGGGGAGGTCTAAGG + Intronic
1062108550 9:134768963-134768985 CTAAGCTGTGTGGAGGGGGGAGG + Intronic
1062189301 9:135239514-135239536 CTGAGCTCTGGGGACATGGCAGG - Intergenic
1062264238 9:135679599-135679621 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264275 9:135679697-135679719 CTCACCTGTGGGGAGGGGGAGGG - Intergenic
1062264285 9:135679726-135679748 CTGACCTGTGGGGAGGGGAGGGG - Intergenic
1062264295 9:135679756-135679778 CTCATCTGTGGGGAGGGGGAGGG - Intergenic
1062264305 9:135679785-135679807 CTGACCTGTGGGGAGGGGAGGGG - Intergenic
1062264319 9:135679820-135679842 CTCACCTGTGGGGAGGGGGAGGG - Intergenic
1062264333 9:135679855-135679877 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264354 9:135679914-135679936 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264375 9:135679973-135679995 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264386 9:135680003-135680025 CTGACCTGGGGGTAGGGGGAGGG - Intergenic
1062489657 9:136799084-136799106 CTGCTCTGTGGGCAGGTGGAGGG - Exonic
1185596205 X:1308519-1308541 CTGAGCTGGAGAGAGGTGGGTGG - Intronic
1187035789 X:15537918-15537940 TTGCCCTGTGGGGAGGTGCATGG + Intronic
1188176657 X:26999132-26999154 ATGGGCTGTGGGGACATGGAAGG + Intergenic
1188568269 X:31551397-31551419 CTTAGCTTTGGGGTGGTAGATGG - Intronic
1189018040 X:37304829-37304851 ATGAGGTGGGGGGAGGGGGAAGG - Intergenic
1189376702 X:40472293-40472315 TTGGGGTGTGGGGAGGAGGAGGG - Intergenic
1190376276 X:49791498-49791520 CTGAGGTGTTGGGAGGTCAATGG + Intergenic
1190634007 X:52417000-52417022 CTGAGCTGAGGTGAGGGGGCTGG + Intergenic
1190701747 X:52994495-52994517 CTGAGCTGTTTGGAGGAGGGAGG - Intronic
1190759757 X:53429707-53429729 CCGAGTTGTAGGGATGTGGAAGG - Intronic
1190955359 X:55187625-55187647 CTGAGCTGAGGTGAGGGGGTTGG - Intronic
1191984337 X:66962192-66962214 CTGGGCAGTGGGGTGGAGGAGGG + Intergenic
1192589528 X:72348280-72348302 ATGGGGTGAGGGGAGGTGGAGGG + Intronic
1192933437 X:75833416-75833438 TTGGGGTGTGGGGAGGTGGGAGG - Intergenic
1193315065 X:80055490-80055512 CTGGGATGGGGGGAGGTGAATGG - Intergenic
1195152327 X:102084696-102084718 CTGGGGTGTGGGGAGATGAAGGG - Intergenic
1195619623 X:106939900-106939922 TAGAGCTGGGGTGAGGTGGAAGG + Intronic
1195679060 X:107530265-107530287 CTGAGCTGTGGTGGTGTAGAGGG - Intronic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196720755 X:118851560-118851582 GTGGGGTGTGGGGAGGGGGAGGG - Intergenic
1197728194 X:129790357-129790379 CTGAGGTGTGGTGAGGTAGGGGG + Intronic
1197878177 X:131133985-131134007 GTGAGGTGGGGGGAGGGGGAAGG - Intergenic
1198111177 X:133503798-133503820 GTGAGCTGAGCTGAGGTGGAGGG - Intergenic
1198254617 X:134914530-134914552 CAGAGGTCTGGGGAGGGGGAAGG + Intronic
1198423512 X:136492424-136492446 CTAAGCTGTGTGCAGGTGTATGG + Exonic
1198682682 X:139199685-139199707 GTGAGCTGTGGGGCGAAGGAAGG - Intronic
1200090912 X:153635538-153635560 CTGGGCTCTGGGGAGGCGGGTGG + Intergenic
1200162290 X:154015788-154015810 CTGGGCTGGGGGCAGGGGGAAGG - Intronic
1200698083 Y:6378813-6378835 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
1201036029 Y:9785886-9785908 GTGGGGTGGGGGGAGGTGGAGGG + Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic