ID: 1163762338

View in Genome Browser
Species Human (GRCh38)
Location 19:19144595-19144617
Sequence GCACCCCAGGTGGTCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163762338_1163762346 19 Left 1163762338 19:19144595-19144617 CCCACTGAGACCACCTGGGGTGC No data
Right 1163762346 19:19144637-19144659 GCTGCACCTCAACTATTTTCTGG No data
1163762338_1163762347 20 Left 1163762338 19:19144595-19144617 CCCACTGAGACCACCTGGGGTGC No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163762338 Original CRISPR GCACCCCAGGTGGTCTCAGT GGG (reversed) Intergenic