ID: 1163762339

View in Genome Browser
Species Human (GRCh38)
Location 19:19144596-19144618
Sequence CGCACCCCAGGTGGTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163762339_1163762347 19 Left 1163762339 19:19144596-19144618 CCACTGAGACCACCTGGGGTGCG No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762339_1163762346 18 Left 1163762339 19:19144596-19144618 CCACTGAGACCACCTGGGGTGCG No data
Right 1163762346 19:19144637-19144659 GCTGCACCTCAACTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163762339 Original CRISPR CGCACCCCAGGTGGTCTCAG TGG (reversed) Intergenic