ID: 1163762342

View in Genome Browser
Species Human (GRCh38)
Location 19:19144608-19144630
Sequence TATCTGGCCTCACGCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163762342_1163762349 25 Left 1163762342 19:19144608-19144630 CCTGGGGTGCGTGAGGCCAGATA No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762342_1163762347 7 Left 1163762342 19:19144608-19144630 CCTGGGGTGCGTGAGGCCAGATA No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762342_1163762346 6 Left 1163762342 19:19144608-19144630 CCTGGGGTGCGTGAGGCCAGATA No data
Right 1163762346 19:19144637-19144659 GCTGCACCTCAACTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163762342 Original CRISPR TATCTGGCCTCACGCACCCC AGG (reversed) Intergenic