ID: 1163762343

View in Genome Browser
Species Human (GRCh38)
Location 19:19144624-19144646
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163762343_1163762349 9 Left 1163762343 19:19144624-19144646 CCAGATAGACCCTGCTGCACCTC No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762343_1163762347 -9 Left 1163762343 19:19144624-19144646 CCAGATAGACCCTGCTGCACCTC No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762343_1163762346 -10 Left 1163762343 19:19144624-19144646 CCAGATAGACCCTGCTGCACCTC No data
Right 1163762346 19:19144637-19144659 GCTGCACCTCAACTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163762343 Original CRISPR GAGGTGCAGCAGGGTCTATC TGG (reversed) Intergenic