ID: 1163762347

View in Genome Browser
Species Human (GRCh38)
Location 19:19144638-19144660
Sequence CTGCACCTCAACTATTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163762338_1163762347 20 Left 1163762338 19:19144595-19144617 CCCACTGAGACCACCTGGGGTGC No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762339_1163762347 19 Left 1163762339 19:19144596-19144618 CCACTGAGACCACCTGGGGTGCG No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762343_1163762347 -9 Left 1163762343 19:19144624-19144646 CCAGATAGACCCTGCTGCACCTC No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762341_1163762347 10 Left 1163762341 19:19144605-19144627 CCACCTGGGGTGCGTGAGGCCAG No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data
1163762342_1163762347 7 Left 1163762342 19:19144608-19144630 CCTGGGGTGCGTGAGGCCAGATA No data
Right 1163762347 19:19144638-19144660 CTGCACCTCAACTATTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163762347 Original CRISPR CTGCACCTCAACTATTTTCT GGG Intergenic