ID: 1163762349

View in Genome Browser
Species Human (GRCh38)
Location 19:19144656-19144678
Sequence CTGGGAGCACCCCTGACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163762345_1163762349 -1 Left 1163762345 19:19144634-19144656 CCTGCTGCACCTCAACTATTTTC No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762341_1163762349 28 Left 1163762341 19:19144605-19144627 CCACCTGGGGTGCGTGAGGCCAG No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762343_1163762349 9 Left 1163762343 19:19144624-19144646 CCAGATAGACCCTGCTGCACCTC No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762348_1163762349 -10 Left 1163762348 19:19144643-19144665 CCTCAACTATTTTCTGGGAGCAC No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762342_1163762349 25 Left 1163762342 19:19144608-19144630 CCTGGGGTGCGTGAGGCCAGATA No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data
1163762344_1163762349 0 Left 1163762344 19:19144633-19144655 CCCTGCTGCACCTCAACTATTTT No data
Right 1163762349 19:19144656-19144678 CTGGGAGCACCCCTGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163762349 Original CRISPR CTGGGAGCACCCCTGACCTC AGG Intergenic