ID: 1163764134

View in Genome Browser
Species Human (GRCh38)
Location 19:19153041-19153063
Sequence TGGGTCCCTGGGGGGTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163764111_1163764134 30 Left 1163764111 19:19152988-19153010 CCAGCCGGAATCGGGCCTGTTCC No data
Right 1163764134 19:19153041-19153063 TGGGTCCCTGGGGGGTGGACGGG No data
1163764112_1163764134 26 Left 1163764112 19:19152992-19153014 CCGGAATCGGGCCTGTTCCCACG No data
Right 1163764134 19:19153041-19153063 TGGGTCCCTGGGGGGTGGACGGG No data
1163764118_1163764134 8 Left 1163764118 19:19153010-19153032 CCACGGCTGGGATATGTTGCCCC No data
Right 1163764134 19:19153041-19153063 TGGGTCCCTGGGGGGTGGACGGG No data
1163764117_1163764134 9 Left 1163764117 19:19153009-19153031 CCCACGGCTGGGATATGTTGCCC No data
Right 1163764134 19:19153041-19153063 TGGGTCCCTGGGGGGTGGACGGG No data
1163764116_1163764134 15 Left 1163764116 19:19153003-19153025 CCTGTTCCCACGGCTGGGATATG No data
Right 1163764134 19:19153041-19153063 TGGGTCCCTGGGGGGTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163764134 Original CRISPR TGGGTCCCTGGGGGGTGGAC GGG Intronic