ID: 1163764813

View in Genome Browser
Species Human (GRCh38)
Location 19:19157550-19157572
Sequence CAAAACTCACTGATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163764811_1163764813 29 Left 1163764811 19:19157498-19157520 CCATCGAGAAGATGCACTGTGTG No data
Right 1163764813 19:19157550-19157572 CAAAACTCACTGATGCAGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163764813 Original CRISPR CAAAACTCACTGATGCAGCT GGG Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901125727 1:6927326-6927348 AAAAAATCACTGAGGCGGCTGGG - Intronic
906393262 1:45437548-45437570 CTTACCTCACTGTTGCAGCTAGG + Intronic
909743033 1:79055990-79056012 CAACACTGAGTGAGGCAGCTTGG + Intergenic
911603714 1:99876168-99876190 AAAAAATCATTGAGGCAGCTGGG - Intronic
911902262 1:103521765-103521787 CAAGACTCACAGATACAGTTAGG + Intergenic
919295993 1:195700758-195700780 CAAAACTCATTTTTGCAGATGGG + Intergenic
919961080 1:202469521-202469543 CAAAACTCACTCATGCTACTTGG - Intronic
920740378 1:208576330-208576352 AAAACCACACTGATGGAGCTTGG + Intergenic
923325813 1:232879086-232879108 CAAAACTCACTGTTACATCCTGG + Intergenic
924413141 1:243828010-243828032 CAAAAATCACTGATGCTGACCGG - Intronic
1062898611 10:1124532-1124554 CAAATCTCACTGATCCAACCTGG - Intronic
1064168727 10:13009950-13009972 CAAAACTGAATGATATAGCTGGG + Intronic
1065117006 10:22493093-22493115 CAAAACTAATTGATGCAACCAGG + Intergenic
1066010468 10:31189685-31189707 CAGAAATCAGAGATGCAGCTAGG + Intergenic
1067918194 10:50423365-50423387 AAAAACTCACTGGTCCAGTTTGG + Intronic
1068332728 10:55592421-55592443 CAAAACTCAAAGATCCAGCCAGG + Intronic
1069413552 10:68177426-68177448 CAAATTTCATTTATGCAGCTTGG - Intronic
1072763932 10:98080943-98080965 CCAGCCTCACTGCTGCAGCTTGG - Intergenic
1073663303 10:105501919-105501941 CAAAAATCAGTGATGGAGATGGG - Intergenic
1074041147 10:109790473-109790495 CAAAAAACACTGGTGCAGATAGG - Intergenic
1075349278 10:121709361-121709383 CAAATATCTCTGATGAAGCTTGG + Intergenic
1076364608 10:129914038-129914060 CAAAACCCACTCATGCAATTTGG + Intronic
1077241669 11:1513791-1513813 CAAAGCTCACTGATGGCTCTAGG + Intergenic
1080472587 11:32560559-32560581 AAAAACTCACTTAGGAAGCTGGG + Intergenic
1081832709 11:46127548-46127570 CAGAAGTAACTGATGCAGATTGG + Intergenic
1085689848 11:78655991-78656013 CAAAGCGCACTGCTGCAGCAGGG + Exonic
1086062992 11:82719506-82719528 CAGATGTGACTGATGCAGCTGGG - Intergenic
1088762608 11:112946755-112946777 CCAAACTCCCTCATGCTGCTGGG + Intergenic
1089645207 11:119874352-119874374 CAAACCTGACTCCTGCAGCTGGG + Intergenic
1089795966 11:120981149-120981171 CAAAACACCCTGATTCAACTGGG - Intronic
1090647616 11:128778403-128778425 CAAAACTCACCTATGGGGCTGGG - Intronic
1091367146 11:135031772-135031794 CAACACTCACTCCTGCTGCTTGG - Intergenic
1091785742 12:3242477-3242499 CAGAACTCACTGTGGGAGCTTGG - Intronic
1092573517 12:9752110-9752132 AAAAACTCAATGATGTAGTTTGG - Intergenic
1093202981 12:16211925-16211947 TAAAAATGACTAATGCAGCTTGG + Intronic
1096132992 12:49175321-49175343 CAAAATTGACTGAGGCGGCTGGG - Intergenic
1101309495 12:103563564-103563586 CTTAGCTCACTCATGCAGCTGGG + Intergenic
1103301560 12:119931586-119931608 CAAAACACATTGAGGGAGCTAGG + Intergenic
1104015738 12:124960517-124960539 CAAAACTCAGTCATGCCACTGGG + Intronic
1105974829 13:25464370-25464392 CCAAACCCCCTAATGCAGCTGGG + Intronic
1108849340 13:54707935-54707957 CACAGCTCAGTGAGGCAGCTAGG + Intergenic
1110708173 13:78619478-78619500 CAGAAGTCACTGATGGAGTTAGG + Intronic
1112108781 13:96271536-96271558 CAAAACTCACTGATACAGCAAGG - Intronic
1113116601 13:106880486-106880508 CACAACTCTGTGATGGAGCTGGG + Intergenic
1113681558 13:112248241-112248263 CAGAACTCACTGAGGAAGATTGG + Intergenic
1114071738 14:19115505-19115527 CAAAACTCAAGGATGCCACTTGG - Intergenic
1114090522 14:19284459-19284481 CAAAACTCAAGGATGCCACTTGG + Intergenic
1119786396 14:77317610-77317632 CAAACCTTACTGAAGCAGTTTGG + Intronic
1121106647 14:91284283-91284305 CAGGACTCACTGTTGCAGTTCGG + Intronic
1121818540 14:96946663-96946685 CAAAACTAACTGAGGCATATAGG + Intergenic
1124807310 15:32898568-32898590 CATAAAGCACTGAGGCAGCTAGG + Intronic
1125044273 15:35228634-35228656 TAAAACTCACTGGTTCAGCCTGG - Intronic
1125886293 15:43232156-43232178 CAAAACTCACTGACGCACTGTGG - Intergenic
1130156192 15:81352047-81352069 CAAACCCCACTGATGCAGGCTGG - Intronic
1131576160 15:93593468-93593490 CAAAATTCACTGCTGAAGCTGGG - Intergenic
1135907397 16:26525494-26525516 CCAAAATTACAGATGCAGCTGGG + Intergenic
1137677375 16:50310380-50310402 AAAAACTCAGGGAGGCAGCTTGG + Intronic
1139552251 16:67680672-67680694 CAAACCTCAGTGCTGCAGCAAGG + Intronic
1139968443 16:70758623-70758645 CAGAACTCACTCAGGCAGCATGG + Intronic
1141046696 16:80721871-80721893 CCAAACTCACTGAACCTGCTGGG + Intronic
1141059156 16:80849052-80849074 CCAAACTCAATGATGCAGGAAGG + Intergenic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151944597 17:77312491-77312513 CCAAAGTCACTGAGTCAGCTAGG - Intronic
1152463057 17:80451325-80451347 CAAAGCTAACTGATACAGCCAGG + Intergenic
1153894537 18:9546388-9546410 CAAAACTCACAGAAGCACCAGGG + Intergenic
1158691072 18:59661266-59661288 AATAACTCACTGAAGAAGCTGGG + Intronic
1159024679 18:63172350-63172372 CTAAACACCCTGATGCTGCTTGG + Intronic
1160158980 18:76456719-76456741 CAAAACTCACTGATTCACATGGG + Intronic
1162499740 19:11045730-11045752 CAAGACTGACTGTAGCAGCTGGG - Intronic
1163764813 19:19157550-19157572 CAAAACTCACTGATGCAGCTGGG + Intronic
930801902 2:55451657-55451679 CTAAAGTGAGTGATGCAGCTGGG - Intergenic
935676655 2:105600277-105600299 CTAAACTCACTGCTGATGCTCGG + Intergenic
936922220 2:117700505-117700527 CAAAGCAAACTGATGCAACTAGG + Intergenic
938485989 2:131709088-131709110 CAAAACTCAAGGATGCCACTTGG - Intergenic
944892475 2:204131667-204131689 CAAAATCCAGTGATGCAGTTTGG - Intergenic
947184396 2:227442045-227442067 CAAAATTCACAGATACAGGTCGG - Intergenic
947787408 2:232835982-232836004 CAAACAGCACTGATGCAGTTAGG + Intronic
1169418449 20:5438713-5438735 GAAAAATAGCTGATGCAGCTGGG - Intergenic
1174718225 20:52783371-52783393 CAAATCTTACTGATGCAGGATGG + Intergenic
1175066635 20:56294707-56294729 CAAAACCCACTGATACTGTTTGG + Intergenic
1177969456 21:27770372-27770394 AAAATTTCACTGAAGCAGCTGGG + Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1180490176 22:15837856-15837878 CAAAACTCAAGGATGCCACTTGG - Intergenic
1181568034 22:23751453-23751475 CAGAAGCCACTGAGGCAGCTGGG + Intergenic
1182051910 22:27318870-27318892 CAAGGCTCAGGGATGCAGCTGGG + Intergenic
1183417875 22:37692877-37692899 CAAAACCCACTGATGAAGGCTGG + Exonic
949577918 3:5356832-5356854 AAAAACTCACCCATGAAGCTGGG - Intergenic
950676689 3:14558441-14558463 CCAAAGGCACTGATGGAGCTAGG - Intergenic
952950628 3:38522011-38522033 AAAAATTCATTTATGCAGCTGGG - Intronic
957096830 3:75784952-75784974 AAGAACTCACTGATGCCGCGAGG - Exonic
958850376 3:99318034-99318056 TAAAACTGACTGAGGCAGTTGGG + Intergenic
959220175 3:103508058-103508080 AAAAACTACCTGATGCACCTTGG - Intergenic
959659409 3:108849242-108849264 CAAAACTCACCTGTGCAGATGGG - Exonic
960724086 3:120652977-120652999 CAAAACTCACTGATGTGCCTGGG - Intronic
965207548 3:165741792-165741814 GAAAACACCCTGATGAAGCTCGG + Intergenic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
968179250 3:196579019-196579041 CAGAACTCACTGATGCCTCCAGG - Intronic
970261782 4:14232148-14232170 CAATACTGACTAATACAGCTTGG + Intergenic
970497047 4:16636793-16636815 CAAAAAGCTCTGAAGCAGCTGGG + Intronic
970954511 4:21794592-21794614 AAAAACTCACTGAGACAGCCGGG + Intronic
971286607 4:25296186-25296208 AAAAACTCATTGGTGAAGCTGGG - Intergenic
973722660 4:53741121-53741143 GATAACTTACTGATGCAGCTTGG + Intronic
979223608 4:118259259-118259281 CACAGCTCACTGATTGAGCTGGG + Intergenic
984131805 4:175885318-175885340 CAAAAGTAATTGATGCAGATAGG + Intronic
985128065 4:186714782-186714804 AAATACTCACTAATCCAGCTGGG + Intronic
986000046 5:3623260-3623282 CAAAACTCACTGCACCCGCTGGG + Intergenic
988473724 5:31564680-31564702 CAAAACACAATTATGCAGCCGGG + Intergenic
989573869 5:42971277-42971299 CAAAGCTGCCTGATGCAGCCTGG + Intergenic
990980501 5:61598567-61598589 CAAATGTTACTGATTCAGCTGGG + Intergenic
991513576 5:67408213-67408235 AAAAAACCACTGATGCAGTTTGG - Intergenic
992492212 5:77255981-77256003 CAAAACTCACTTCTACAGCCAGG - Intronic
994650925 5:102526764-102526786 CAAAAATCACTGTTGAATCTTGG + Intergenic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
997304673 5:132828873-132828895 CAAAACACACCAAAGCAGCTGGG - Intronic
999226230 5:150027055-150027077 CCAAGCACACTGAAGCAGCTGGG + Exonic
999530700 5:152460449-152460471 CAAAACTCTCTGAGGCAGGAAGG - Intergenic
1003516588 6:6823689-6823711 CAAACCTCACAGATGCAGACTGG + Intergenic
1006905467 6:37530337-37530359 CAACACTCACTAAGGCTGCTTGG + Intergenic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1009038298 6:58145018-58145040 CAAAACTGACTGACACAGATAGG + Intergenic
1009214089 6:60898648-60898670 CAAAACTGACTGACACAGATAGG + Intergenic
1010396456 6:75398333-75398355 CAAAACTAACTGGCCCAGCTGGG - Intronic
1014005733 6:116415779-116415801 ACAAACTCATTAATGCAGCTTGG - Intronic
1015690828 6:135920858-135920880 CAGCACTTACTGATGAAGCTAGG - Intronic
1015704777 6:136076173-136076195 CAAAATAAACTGATGCAGCCGGG + Intronic
1018448210 6:163877966-163877988 CAGAACTTACTGATGCTGCTGGG - Intergenic
1021511015 7:21432696-21432718 TAAAACTCACTGAAGTGGCTGGG + Intronic
1024167593 7:46750182-46750204 GAAAACCCACTGATACAGTTTGG - Intronic
1025724215 7:64043005-64043027 TAAAACTCACAGATGCCCCTGGG - Intronic
1026278527 7:68901696-68901718 CAAATCTGACTGATACAGTTTGG + Intergenic
1026353495 7:69537673-69537695 CCAAATTCACTGAAGTAGCTAGG - Intergenic
1028660792 7:93271321-93271343 CAAAACACAATGTTGCACCTAGG - Intronic
1028909138 7:96188343-96188365 CAAAACTCACCGCTGCATTTGGG + Intronic
1029513492 7:101011367-101011389 CAATAGCCAATGATGCAGCTGGG - Intronic
1030615387 7:111733157-111733179 CAAACCTCACTGTGACAGCTGGG - Intronic
1032012906 7:128358705-128358727 CAAAACTTAGGGAAGCAGCTGGG + Exonic
1033377142 7:140772702-140772724 CAAGACTCACTGATGCAATCTGG + Intronic
1034196714 7:149254024-149254046 CACATCACACTGATGCAGCTTGG - Exonic
1039088393 8:33802476-33802498 CAAAACCCATTGGTGAAGCTAGG - Intergenic
1041400632 8:57440621-57440643 CGAAACTCACTGAGGAAGCTGGG + Intergenic
1041605948 8:59782563-59782585 CAATTCCCGCTGATGCAGCTTGG + Intergenic
1042177531 8:66051845-66051867 AAGAACTCACTGATGATGCTGGG + Intronic
1042600498 8:70494714-70494736 GAAAAATCACTGATGGAGCATGG - Intergenic
1042606101 8:70548257-70548279 CAAAACACACTAATACACCTGGG + Intergenic
1043097275 8:75991273-75991295 AAAAGCACACTGATGCATCTGGG - Intergenic
1046139921 8:110078134-110078156 AAAAAATCACTGATGCAGAGAGG + Intergenic
1047232419 8:123008810-123008832 CAAGACTCACTGACCCAGCTTGG - Intergenic
1047326624 8:123844625-123844647 CAAACATCAATGATGGAGCTGGG - Intergenic
1048236276 8:132693843-132693865 CAATACTCACTTAAGCAGGTGGG - Intronic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1049453592 8:142675815-142675837 GAAAACCCACTGATGCACATGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056903480 9:90623742-90623764 CAAAACACAGTTATGGAGCTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059509904 9:114835718-114835740 CAAAAAACACTGAGGCAACTAGG - Intergenic
1059681779 9:116592654-116592676 CAAAACTCACAGATACAGAGGGG + Intronic
1060275768 9:122181263-122181285 CAGAAATGACTGATGCTGCTAGG - Intronic
1062452021 9:136619811-136619833 CACAAGTCACTGAAGCAGCTGGG - Intergenic
1189047081 X:37604870-37604892 CAAAAGTCATTGATGCAGAGAGG + Intronic
1189490788 X:41470396-41470418 TAAAAATCATTGATGCAGCTGGG + Intronic
1197699909 X:129591550-129591572 CAAAACTGCCTGATGCAGTTGGG + Exonic
1200317564 X:155149534-155149556 CAATACTCACTGTTGAAGCAGGG - Intergenic
1202296273 Y:23360807-23360829 CAAAACTCACTCATGCTACTTGG - Intergenic
1202574534 Y:26309789-26309811 CAAAACTCACTCATGCTACTTGG + Intergenic