ID: 1163765265

View in Genome Browser
Species Human (GRCh38)
Location 19:19160295-19160317
Sequence CTGGGAAACCAAAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 0, 3: 62, 4: 501}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163765259_1163765265 14 Left 1163765259 19:19160258-19160280 CCACACGGGGGCCTCTATTGAAC No data
Right 1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 62
4: 501
1163765260_1163765265 3 Left 1163765260 19:19160269-19160291 CCTCTATTGAACTTTTCTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 220
Right 1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 62
4: 501
1163765258_1163765265 17 Left 1163765258 19:19160255-19160277 CCACCACACGGGGGCCTCTATTG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 62
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163765265 Original CRISPR CTGGGAAACCAAAAGGAAGA AGG Intronic
900639930 1:3683856-3683878 CAGGGACCCCCAAAGGAAGATGG + Intronic
903107638 1:21097519-21097541 TTGAAAAACCAAAAGGAAGGGGG + Intronic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
903360531 1:22774191-22774213 CCAGGAAACCCAGAGGAAGAAGG - Intronic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
903783996 1:25844757-25844779 CTGGGAAGCATAAAGGAAGAAGG - Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
905231882 1:36519657-36519679 CTGGAAAGAGAAAAGGAAGAAGG + Intergenic
905821115 1:40992159-40992181 CTGCCAAGCCAACAGGAAGAGGG - Intronic
906096471 1:43227618-43227640 CTGGGAAGCAAACAGGATGAAGG + Intronic
906355054 1:45098188-45098210 CTGGAAAGCCAACAGGAAGCGGG + Intronic
906785331 1:48610723-48610745 CTGGGAAAGTAAAAGTTAGAGGG - Intronic
908561346 1:65309690-65309712 CTGGGAAGCGAAAAGGGAGATGG - Exonic
908666877 1:66502839-66502861 CTGGGAAATAAAAAGAAGGAAGG + Intergenic
908805074 1:67922117-67922139 CAGGGAAACCAAGAGGTTGATGG + Intergenic
909060454 1:70873244-70873266 CTGGTAAACCTAAAGAAAGAAGG - Intronic
909169482 1:72276884-72276906 CTGGGAAGCCAAATAGAAGGTGG + Intronic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
911876972 1:103178871-103178893 CTGGTAAACCAGTAAGAAGAAGG + Intergenic
912228783 1:107767934-107767956 CTGGTAAATCATAAGGAAGTAGG + Intronic
912571512 1:110627661-110627683 AAGGAAAACAAAAAGGAAGAAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
914946412 1:152070768-152070790 GGGGGAAGACAAAAGGAAGACGG - Intergenic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
915800892 1:158792215-158792237 AAGGGAAACTAAAAGGGAGAAGG - Intergenic
916059811 1:161090522-161090544 CTGGGATAGCCAGAGGAAGAGGG + Intergenic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
917371027 1:174294634-174294656 CTGGTAAATAAAAAGTAAGAAGG + Intronic
917617744 1:176763801-176763823 CTGGGAAGTTCAAAGGAAGAGGG + Intronic
918162864 1:181917585-181917607 CTGGGAAACAAAGATGAATAAGG - Intergenic
918211445 1:182354770-182354792 GTTGGGAACCAAAAGGATGAGGG + Intergenic
918581428 1:186135266-186135288 CTGGTAACCAAAAAGGAAGGAGG - Intronic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
920228004 1:204451819-204451841 CAGAGAAACCAAAACCAAGAGGG + Intronic
921016208 1:211193698-211193720 ATAGAAAACCAAAAGCAAGATGG - Intergenic
921049120 1:211498620-211498642 ATGGGAAATCAATGGGAAGAGGG + Intergenic
921333337 1:214062408-214062430 GTTAGAAACCAAGAGGAAGAAGG + Intergenic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921659260 1:217779627-217779649 TTGGGAAAAAAAAAGGAAGAAGG - Intronic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923723273 1:236485193-236485215 CTGGGTAACCAAAAGGGATTTGG - Intergenic
924387949 1:243517826-243517848 GTGGGAAACAAATAGCAAGATGG - Intronic
924480914 1:244433442-244433464 CTAGGAATCCAAAAGGCAAATGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065169808 10:23015243-23015265 CTTCGAAACCAAAAGTAATATGG - Intronic
1065195438 10:23260368-23260390 CCGGCAGACCAAAAGGAAGAGGG + Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065340605 10:24701215-24701237 TGGGGAAACCAAATGGAAGAGGG - Intronic
1066175406 10:32898575-32898597 CCGGGACTCCAAAAGGGAGAGGG + Intergenic
1066226658 10:33389949-33389971 CTGGGAACCCAAGAGGCAGTGGG + Intergenic
1066583126 10:36902149-36902171 CTGAGAAACTAAAAAGAAGCAGG - Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067415988 10:46103570-46103592 TGGGGAAACCAAAAGGAAGTGGG - Intergenic
1067436128 10:46280055-46280077 TGGGGAAACCAAAAGGAAGCGGG - Intergenic
1067756639 10:49010632-49010654 CCAGGAAACTAAAAGGAGGAAGG - Intergenic
1068144766 10:53054023-53054045 CTGGTAAAACAAAACGGAGAGGG + Intergenic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068687077 10:59881409-59881431 CTGGGACACCAAGATAAAGAAGG - Intronic
1068803946 10:61173635-61173657 GGGGGAAAACAAAATGAAGAAGG - Intergenic
1069572365 10:69502067-69502089 CCTGGCAACCAAAAGGAAAAGGG + Intronic
1070100641 10:73382714-73382736 CTGGGGAATCAAAATAAAGAAGG + Intronic
1070637727 10:78142549-78142571 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1072148267 10:92663388-92663410 CTGAGGAACAGAAAGGAAGAAGG - Intergenic
1072343625 10:94480610-94480632 CTGGGAAACCTAAATGCAAAGGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073624002 10:105077395-105077417 TGGGGAAACCAGAAGGATGAAGG + Intronic
1073764777 10:106670132-106670154 CATGAAAACCAAAAAGAAGAGGG + Intronic
1074147651 10:110730764-110730786 TTGGGAAACACAAAGGAAGGAGG - Intronic
1074949048 10:118310868-118310890 ATGGGAAACCAAAAGCAACATGG - Exonic
1074952418 10:118351140-118351162 CTGGGAAAAGCACAGGAAGAAGG - Intergenic
1075055587 10:119215955-119215977 CTGGGAAGACATCAGGAAGAAGG + Intronic
1075157944 10:119995551-119995573 AATGGAAACCAAAAGCAAGATGG - Intergenic
1076064763 10:127440442-127440464 GTGGGAAACAAAAATAAAGAAGG + Intronic
1077557854 11:3234525-3234547 CTCGAAAACATAAAGGAAGATGG - Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1079120936 11:17684360-17684382 CTGGGCAACCCAAACCAAGATGG - Intergenic
1079350643 11:19689071-19689093 TTGGGAATCTAAAAGGAAGGAGG + Intronic
1079456318 11:20639503-20639525 CTCTGAAGCCCAAAGGAAGAGGG + Intronic
1080958912 11:37134737-37134759 ATGGGAAACAAAAAAGAACAGGG + Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1082932244 11:58620495-58620517 TTGGGCAACCACAAAGAAGAGGG - Exonic
1083115623 11:60456576-60456598 ATGGGAAACCAAGAGTAAGAGGG + Intronic
1083493686 11:63032108-63032130 CTAGGAAAACAAAGGGAAAAGGG - Intergenic
1083789738 11:64976797-64976819 CTGGGAAGCCCAAAGGGAGGTGG - Intergenic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088422588 11:109665884-109665906 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
1088813090 11:113404647-113404669 CTGGGAATCCTAAAGGAGCAGGG + Intergenic
1089405250 11:118192264-118192286 CTGTGAAATCAAAAGCAAGCTGG - Intergenic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1090958495 11:131535143-131535165 CTGGGACAGCCAAAGGACGATGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1091690974 12:2597207-2597229 CTGCAAAACAAAAAGGAACAGGG - Intronic
1091993479 12:4974681-4974703 CTGGGAATCCAAAATGAAGGAGG - Intergenic
1092529774 12:9334823-9334845 CTGGGACCCCAAAAGGATGAGGG + Intergenic
1092951712 12:13509758-13509780 CTGAGAAACCAAAGGAAAGCTGG + Intergenic
1093742697 12:22706425-22706447 GTGGGGCAACAAAAGGAAGAAGG + Intergenic
1094424508 12:30304512-30304534 CTGCGCAACCACAAGGGAGAGGG + Intergenic
1094641639 12:32281746-32281768 CTGGGCAGCCAAAAGAAGGAGGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095211266 12:39497960-39497982 TGGGGAATCCAAAAGGAGGAGGG + Intergenic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1095421533 12:42029072-42029094 TTGGGAGAGCAAAAGGAAAAAGG - Intergenic
1095801943 12:46278314-46278336 CTGGGAAACCATTAAGAACATGG - Intergenic
1096183234 12:49562516-49562538 GTGGGAAAAGAAGAGGAAGAAGG + Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1096970756 12:55664490-55664512 CTGGAAAGCCTACAGGAAGAGGG - Intergenic
1097242368 12:57584195-57584217 CTGGGAAAGAAAGAGAAAGAGGG - Intronic
1097681765 12:62656011-62656033 ATGGAAAACAAAAAGGAAGAGGG + Intronic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1097882378 12:64698096-64698118 CTGGGGAACCACAGGGACGATGG + Intergenic
1099308069 12:80982993-80983015 CTTGAATTCCAAAAGGAAGAAGG - Intronic
1099458642 12:82895797-82895819 CTCTGAAACCAAAAGAGAGAAGG - Exonic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1101284901 12:103301780-103301802 CTGCGAAAGCAAAACAAAGAGGG + Intronic
1101492742 12:105224329-105224351 CTGGGATACAAAAAGGAACTGGG + Intronic
1101682273 12:106980857-106980879 ATGGGAAACCAAAATGGAAAGGG - Intronic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1102751139 12:115295784-115295806 ATGAGAGACCAAGAGGAAGAGGG - Intergenic
1103359679 12:120346323-120346345 CTGGCAACCCAGAAAGAAGACGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105716363 13:23069194-23069216 TTGGCAGACCAAAAGGCAGAAGG + Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106399787 13:29418663-29418685 CTGGGAAACCTAAATGCAGCGGG - Intronic
1107100668 13:36587344-36587366 CTAGGAAAAAAAAATGAAGATGG - Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1109421275 13:62115607-62115629 GGGGGAAACCAAAAGCAGGATGG - Intergenic
1110109187 13:71722166-71722188 AAGGAAAGCCAAAAGGAAGATGG - Intronic
1110455745 13:75688562-75688584 ATGGGAAACCAAAAACAACATGG - Intronic
1110713105 13:78671587-78671609 CTGGGAATCCAGGAGGTAGAAGG + Intergenic
1111256580 13:85677405-85677427 CTTGGAAGCTAAAAGCAAGATGG + Intergenic
1111577531 13:90175930-90175952 CTGGCAAAGAAAAGGGAAGATGG - Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113899591 13:113788821-113788843 CTGGGAAACCCCAGGGAAGCTGG + Intronic
1114011924 14:18378315-18378337 CTGAGAAACCAAGAAGAATAAGG + Intergenic
1114402246 14:22420693-22420715 ATGGGAAACCAAAAAGAAGGTGG + Intergenic
1115554339 14:34532536-34532558 ATAGGAAACCTAAAGGAAGAGGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1116353061 14:43890866-43890888 TTGAGAAACCAAAAGTCAGAGGG + Intergenic
1117448301 14:55826391-55826413 CTGGGAAATCAAAAGGTTGGAGG - Intergenic
1118234801 14:63992645-63992667 GGGGAAAACCAAAAGGAAGAAGG - Intronic
1118466499 14:66035712-66035734 CTGGGAAGCAAAAAGAGAGAAGG - Intergenic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1119103308 14:71900393-71900415 CTGGGAGACCAAAAGCCAGTAGG - Intergenic
1119167883 14:72510668-72510690 CTGAGAAGCTAAACGGAAGAGGG + Intronic
1119461432 14:74807643-74807665 TTGGGAAAACAAATGGAAGGAGG + Intronic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1119957398 14:78813852-78813874 AAGTGAAGCCAAAAGGAAGAAGG - Intronic
1120291339 14:82575245-82575267 CTGAGAAAACAAAAAGAAAAAGG + Intergenic
1121950268 14:98165587-98165609 CTGGGAAGCAAAAATGAACATGG - Intergenic
1122002533 14:98672268-98672290 CTGGGACCCTAAAAGGATGAGGG - Intergenic
1122869494 14:104630186-104630208 TTTGGAAAGAAAAAGGAAGAAGG + Intergenic
1124702821 15:31931492-31931514 TAGGGAAACCACAAGGAATAGGG - Intergenic
1125840004 15:42791340-42791362 CTGAGAAACCAAATAGTAGAAGG - Intronic
1126075586 15:44905993-44906015 CTGGCAAAGAAAAAGAAAGAAGG - Intergenic
1126865691 15:52934436-52934458 CTGAGTAACCTAAAGGAACAGGG - Intergenic
1127051115 15:55085129-55085151 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1127952087 15:63818408-63818430 ATGGCAGACGAAAAGGAAGAGGG + Intronic
1128341943 15:66828526-66828548 CTGAGGACCTAAAAGGAAGAAGG - Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128606433 15:69039722-69039744 CTGGGAACCCAAAAAGCAGTGGG - Intronic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1129615764 15:77097944-77097966 CTGGGAAAATAAATGGAACATGG - Intergenic
1130322071 15:82849904-82849926 CTGGCCAAGCAAAAGGGAGAAGG + Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1132209188 15:100007846-100007868 GGGGGAAACCAAAGGTAAGAAGG + Intronic
1132328534 15:100993834-100993856 CTAGGAAACCAGCAGGAATAAGG - Intronic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133830176 16:9315693-9315715 CTGTGACATCAAAAGGGAGACGG + Intergenic
1135963652 16:27018354-27018376 CAGGCAAAGCTAAAGGAAGAAGG + Intergenic
1136559493 16:31030726-31030748 CTGAGAAACAAAGAGGAAGATGG + Intergenic
1137451602 16:48579785-48579807 ATGGAAAACCAAAAGAAAGCAGG + Intronic
1137607193 16:49794747-49794769 CTAGGAAACCAATAGGTGGAAGG - Intronic
1137794789 16:51206756-51206778 CTAGGAAACCAATAGAAGGATGG + Intergenic
1137938831 16:52661196-52661218 CATGGAAACCAAAAGCAAGCAGG + Intergenic
1137973462 16:53009260-53009282 ATTGGAAACCAAAAGGGAGTAGG - Intergenic
1140768405 16:78181036-78181058 TTATGAAACAAAAAGGAAGAAGG - Intronic
1140917399 16:79506553-79506575 CTGGTAGATAAAAAGGAAGACGG + Intergenic
1140921482 16:79542526-79542548 CTTGGATAACAAAAGGAAGCAGG + Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1143790047 17:9287519-9287541 CTGGGAGCCAAACAGGAAGAGGG - Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144316054 17:14062625-14062647 CTGGGGAAACAAAAAGAAGTTGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144811893 17:18005851-18005873 CTGGGAAACCCAAAGGAGAGGGG + Intronic
1146238401 17:31189310-31189332 CTAGGAGACAAAAAGGAACAAGG - Intronic
1148478079 17:47942003-47942025 CGGGGAAACGCAAATGAAGATGG + Intronic
1148707195 17:49645837-49645859 ATGGGAAACGTCAAGGAAGAAGG - Intronic
1149272824 17:55000193-55000215 CTAAGGAACAAAAAGGAAGATGG - Intronic
1149478010 17:56979464-56979486 CTGGGAAAAAAAAAAGTAGAGGG - Intronic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149968832 17:61195358-61195380 CTGGGAAAATAAAAGGAAATAGG - Intronic
1150008836 17:61486699-61486721 CTGGAATAACAAAAGGGAGAAGG + Intergenic
1150235199 17:63587322-63587344 CTGGGAAAAAAAAAAAAAGAGGG - Intronic
1150352299 17:64455050-64455072 TTGTGAAAGGAAAAGGAAGAAGG + Intronic
1151021573 17:70623314-70623336 CTGGGAAACATAGAGGAACAAGG - Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151198805 17:72452673-72452695 CTGAGCAACCACAGGGAAGAAGG + Intergenic
1151334977 17:73434416-73434438 CTTGGAAGCCAGAAGCAAGACGG + Intronic
1152315404 17:79577745-79577767 CTGGAAAACCCAAAGGAGAAGGG + Intergenic
1153215029 18:2811543-2811565 ATGGAAAACAAAAAGTAAGATGG + Intergenic
1153327153 18:3832664-3832686 CTGGGAAAAAAAAAAAAAGAAGG - Intronic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153705356 18:7739556-7739578 ATGGGAAAGCAAAAGGAAAATGG - Intronic
1154229532 18:12542477-12542499 ATGGGAAAACAAATAGAAGATGG - Intronic
1154265561 18:12875759-12875781 TTTGGAGACCAAAGGGAAGAAGG + Intronic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157786183 18:50485080-50485102 ATTGGAAAGTAAAAGGAAGAGGG - Intergenic
1158131143 18:54153744-54153766 CTGGGAAGCCAATTGGTAGAGGG - Exonic
1158387194 18:57008276-57008298 GAGGGAAACAGAAAGGAAGAAGG - Intronic
1158426311 18:57342666-57342688 TTGGGAAAACACAACGAAGATGG + Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164798152 19:31053229-31053251 CTGTGAAACCAAAGACAAGAAGG - Intergenic
1165348762 19:35265561-35265583 CTGGGACCCCAACAGGAAAATGG - Intronic
1165587835 19:36935991-36936013 ATGGAAAACAAAAAGGAAAATGG - Intronic
1166340369 19:42133431-42133453 CTCGGGCACCAAGAGGAAGAGGG - Intronic
1167214240 19:48153881-48153903 CAGAGAAGCCAAGAGGAAGAAGG - Exonic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167772959 19:51532090-51532112 CTGGGACAGTGAAAGGAAGAAGG + Intergenic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
1168707501 19:58478244-58478266 CTGGAAAACCACCAGGCAGAGGG - Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
927080829 2:19629116-19629138 CTGGAAAACCTACAGGAAAATGG + Intergenic
927352481 2:22133678-22133700 CTGGGAAGACAAGAGGAAGGAGG - Intergenic
927653462 2:24926691-24926713 CGCGGAAACCAAAGGGAAGAAGG - Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
930905870 2:56566737-56566759 CTGGGAAATAAAAAGGATGAGGG - Intergenic
931200435 2:60092476-60092498 CTGGCAAAAGAAAAGGAAAAAGG - Intergenic
931683720 2:64774215-64774237 CTGGGAAACCAAAATAAATTAGG - Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933859229 2:86447981-86448003 CTAGGAAACAGAAAGGAAGATGG + Intronic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
935705799 2:105856136-105856158 CTGGGAAAACAAGAGGCACATGG - Intronic
935850823 2:107216985-107217007 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936411719 2:112264472-112264494 CTAGGAGACCATAATGAAGAAGG + Intergenic
936892380 2:117387561-117387583 CATGGAAACCAAAAGCAAGTGGG - Intergenic
937763171 2:125629693-125629715 CTGGGAAAACAAAAGAAACAAGG + Intergenic
937792941 2:125981656-125981678 CAGGGAAACCATTTGGAAGATGG - Intergenic
938343831 2:130552602-130552624 CTGCTAAACCAAAAGGAACCAGG - Intergenic
938346002 2:130568120-130568142 CTGCTAAACCAAAAGGAACCAGG + Intergenic
938657415 2:133448246-133448268 CTGGGAAAAAAAAAAAAAGAGGG + Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940270007 2:151880285-151880307 CTGGGAAACAGAAAGGCAAAAGG - Intronic
941376452 2:164737234-164737256 CCAGGAAAGCAAAGGGAAGAGGG + Intronic
942758668 2:179372290-179372312 CTGGGAAATCAAAAGGGAGTTGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943927078 2:193798701-193798723 ATGGGAAAAAAAAAGAAAGAAGG + Intergenic
944291601 2:198013416-198013438 CTGGGAAACAAAAAGGCTTAAGG - Intronic
944981413 2:205124947-205124969 TTGGGATACCAAAAGCAAGAGGG + Intronic
945480458 2:210339048-210339070 AAGGGAAACCAAAAGCAAGCAGG - Intergenic
945572353 2:211484333-211484355 CTGGAAAACAAATAGCAAGATGG + Intronic
946052596 2:216876543-216876565 CTGGGAAACAAAAGGGACAAAGG - Intergenic
946430202 2:219622166-219622188 CTGGAAGAACAAAAGGCAGAAGG + Intergenic
947172695 2:227326466-227326488 CTTTGAAACCAAAAGATAGAAGG - Intronic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
948227153 2:236320191-236320213 GTGGGAAACCAAAAGGACCTTGG - Intergenic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
1168850005 20:969972-969994 ATGGGGCACCAATAGGAAGAGGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169546345 20:6654790-6654812 CTGTGAAACCAAAGGCAAAATGG - Intergenic
1170396750 20:15934118-15934140 CTGGGAAACTAAAGGGAACAGGG - Intronic
1171008668 20:21493617-21493639 TTGGGAAACCAAAGAGAATAAGG + Intergenic
1171025640 20:21628265-21628287 CTGGCAAGCCAGAAGTAAGAGGG - Intergenic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1175012942 20:55758134-55758156 CTCTGAACCCAAAAGGAAAAAGG + Intergenic
1177714653 21:24823329-24823351 ATGGGAAACCGCAAGGAAGGAGG - Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1178026522 21:28474601-28474623 CTGAGATACCAAAAGGAATGGGG - Intergenic
1179094440 21:38299686-38299708 CTGAGCAACCAACAGGAAGATGG - Exonic
1180436416 22:15309123-15309145 CTGAGAAACCAAGAAGAATAAGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181257097 22:21569679-21569701 GTGGGAAACCAAAGGGCAGGAGG - Intronic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1183131345 22:35839749-35839771 CTGAGAAACCAAAGTGAACAAGG + Intronic
949642083 3:6047984-6048006 CTGGCAAAGAGAAAGGAAGAGGG - Intergenic
949713860 3:6905054-6905076 TTGGGAAAGCAAAACCAAGACGG - Intronic
950048861 3:9970662-9970684 CTGGCAAAGCAAAATGAAAATGG + Intronic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950856945 3:16114692-16114714 CTTGGAAACAAACAGGAACAAGG - Intergenic
951903096 3:27676830-27676852 TTGGGAAATTAAAAGGAGGAAGG - Intergenic
952421096 3:33132090-33132112 CTGGAAAACCCAAAGGATGGTGG - Intronic
952651576 3:35733721-35733743 CTGAGAAACATAAAAGAAGATGG - Intronic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
954156988 3:48691002-48691024 CTAGGTAACCTAGAGGAAGAGGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
955416086 3:58692754-58692776 CTTGGAAATTAAAAGCAAGATGG - Intergenic
955568601 3:60277483-60277505 CTGGCAAAGAAAAGGGAAGATGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
955756469 3:62229641-62229663 CTGAGAAATCCAAAGAAAGATGG - Intronic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956914189 3:73853452-73853474 CAGAGGAACCAAAAGGAAAAAGG + Intergenic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
958132447 3:89445646-89445668 GTGGGAAAGCATAAGGAAGTGGG - Intronic
958509010 3:95021503-95021525 CTTGGAAACCTAGAGGAAAAGGG - Intergenic
959765050 3:110016397-110016419 CTGGGAAAACAAAAAGAAAGAGG + Intergenic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961489342 3:127242355-127242377 AAGGCAAACCAAAAGCAAGAAGG + Intergenic
963600017 3:147371058-147371080 GTGGGAAACCAAAAGTGAGGTGG - Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
965077202 3:163994042-163994064 CTGAGAAACCAAAGTGTAGAAGG - Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966499559 3:180624240-180624262 CATGGAAACCAAAAGCAAGTAGG - Intronic
966632048 3:182087380-182087402 CTGCAAAACCAAAAGTAAGCAGG + Intergenic
966821636 3:183929495-183929517 CAGGTAAACCAAGAGAAAGAGGG - Intronic
966881960 3:184355554-184355576 CTGGGAAACCGACAGGATGAAGG + Intronic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
969130704 4:4989291-4989313 CTGAGACAGCAAAAGAAAGAAGG - Intergenic
969574280 4:8027508-8027530 CTTGGAAAGCTACAGGAAGAGGG - Intronic
970116595 4:12703392-12703414 CTGGGAAACTAATAGGGAGAAGG + Intergenic
970246526 4:14070318-14070340 CTGGGAAGCCGAGGGGAAGATGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
970766156 4:19551321-19551343 GGGAGAAACCAAAAAGAAGAAGG - Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
971897520 4:32616828-32616850 CTGGGAAACCAAAATGCAATGGG + Intergenic
972938140 4:44165449-44165471 CTGGGAAACAAAAATGTACAGGG + Intergenic
973981510 4:56312099-56312121 CTGAGAAGATAAAAGGAAGAGGG - Intronic
974115630 4:57575807-57575829 CTGGGAAAACAAAAAGGAAAAGG - Intergenic
975285808 4:72618136-72618158 CAGGGAAAGCAAAATTAAGAGGG + Intergenic
975393193 4:73844213-73844235 CTTGGAAATCAAAGGGAATAAGG + Intronic
975911714 4:79274916-79274938 CTTGGAAAGCAAAAGAAAAAAGG - Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
976587981 4:86820056-86820078 GAGGGACACCAAAAGGATGAGGG - Intergenic
977743139 4:100511654-100511676 CTTTGAAATGAAAAGGAAGAAGG + Intronic
978018921 4:103785033-103785055 CTGACAAACAGAAAGGAAGATGG - Intergenic
978562837 4:110051763-110051785 CTGGAAGACAAAGAGGAAGAAGG + Intronic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
978873107 4:113604639-113604661 CTTTGAAACCAAAGTGAAGAAGG - Intronic
979641233 4:123014153-123014175 CTGGGAAAGATAAAGGAATATGG - Intronic
979808205 4:125001657-125001679 TTGGGGAGGCAAAAGGAAGATGG + Intergenic
980717067 4:136640277-136640299 GGGGGAAACCAAAAGGGGGATGG - Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981215477 4:142160820-142160842 TTGTGAAACTAAAAGGGAGAAGG - Intronic
981561412 4:146052561-146052583 CTGGGGAACCCAAACAAAGATGG - Intergenic
981627756 4:146778809-146778831 CCTGGACTCCAAAAGGAAGAAGG + Intronic
981951361 4:150411878-150411900 GTGGTAAACCAAAAAGAGGAGGG + Intronic
982208868 4:153019106-153019128 CTGGGGGACTAAAAGGCAGAGGG + Intergenic
984147702 4:176083987-176084009 CTGGCAAACCAATAGAAAAATGG - Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984326795 4:178265248-178265270 CTGGGAACCTAAGAGGACGAAGG + Intergenic
985534273 5:454587-454609 CTAGGATACAAAAAGGATGATGG - Intronic
986746725 5:10751198-10751220 CTGGAAACCCAAAACGAAGAAGG - Intronic
987010954 5:13764053-13764075 ATTGAAAACCAAAAGAAAGATGG + Intronic
987207392 5:15641443-15641465 CAGGGAAACCAAGAGGAATGGGG + Intronic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987648006 5:20701020-20701042 CTGGAAAACCAAACTGAAGCAGG + Intergenic
987688560 5:21237382-21237404 CTAGGCAACAAAGAGGAAGAGGG + Intergenic
987866035 5:23540357-23540379 CCCTGAAAACAAAAGGAAGAAGG - Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
991208796 5:64080857-64080879 TAGGGACACCAAAAGGAGGATGG - Intergenic
992013675 5:72555735-72555757 CTGAGAAAGCTAATGGAAGATGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992209182 5:74460910-74460932 CTCAAAAACCAAAAGGAAGTTGG + Intergenic
992268925 5:75046234-75046256 CTGGAAAGGCTAAAGGAAGAAGG + Intergenic
993025245 5:82637922-82637944 CTAGGAAACCAGTAGCAAGAAGG + Intergenic
993215305 5:85015037-85015059 CAGGTAAAGCAAAAGAAAGAAGG + Intergenic
993738502 5:91507224-91507246 CTGGTAGAACCAAAGGAAGAAGG + Intergenic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
996163073 5:120191242-120191264 TTGGGAAGCCAAAAGAGAGAAGG + Intergenic
996334170 5:122365155-122365177 TAGGGAAAGCAAAAAGAAGATGG - Intronic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
999104326 5:149056694-149056716 CTGAGAAACAATAAGGAAGCTGG + Intronic
1000442260 5:161277886-161277908 CACAGAGACCAAAAGGAAGATGG - Intergenic
1000965964 5:167657110-167657132 CTGGGAAACATAGGGGAAGAAGG - Intronic
1001113421 5:168918079-168918101 TTGGGAAAAAAAAAGGGAGAGGG - Intronic
1001161247 5:169316882-169316904 CTCGGAAAGCTAAAGGAAAAGGG + Intergenic
1001169438 5:169404790-169404812 CTGGGAAAAAAAAATCAAGATGG - Intergenic
1001575273 5:172759236-172759258 CTGGGAAAAGAAAAGTCAGAGGG + Intergenic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1003080834 6:3019941-3019963 CTGGGAATCCAAAAGCGGGAAGG - Intergenic
1003498915 6:6687811-6687833 CAGGGACCCCAAAAGGAAGGAGG - Intergenic
1004631669 6:17427235-17427257 CTGGGAAAAGATAAGGGAGAGGG + Intronic
1004984698 6:21068032-21068054 CTGGTAAACCAACAGGTAGATGG - Intronic
1005326301 6:24704057-24704079 CTGGGACAACAAAACGAATATGG + Exonic
1005486444 6:26304925-26304947 CAGCGAAACCAAAACTAAGAAGG + Intergenic
1005526708 6:26658579-26658601 TTTTGAAACCAAAAGGAAGATGG - Exonic
1006651425 6:35554919-35554941 CTGGCCAGCCAAAAGGAAGTGGG + Intergenic
1006847512 6:37072799-37072821 CTTGCAAACAAACAGGAAGAGGG + Intergenic
1007013244 6:38437862-38437884 ATGGGAAAACAAAATGAAAAGGG + Intronic
1007821496 6:44563663-44563685 AGGGGACAACAAAAGGAAGATGG + Intergenic
1007948184 6:45844677-45844699 CTGGTAAACCAAGAGAAAGTGGG - Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1008258835 6:49339713-49339735 CAAGGACACCTAAAGGAAGAGGG - Intergenic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1009747012 6:67829449-67829471 CTGGGAAACAGAAATGAAGGAGG - Intergenic
1011041811 6:83037836-83037858 CTGGGGAACCAAAAGAATAAGGG + Intronic
1011326313 6:86152541-86152563 ATGGGGAACCAAATGGCAGATGG + Intergenic
1011492178 6:87903476-87903498 CATGGAAACCAAAGGGAAGGTGG - Intergenic
1011782058 6:90800558-90800580 TTGTGAAAGCTAAAGGAAGAAGG + Intergenic
1012351150 6:98252230-98252252 CTGTGAAACCAAAATGGAGAAGG - Intergenic
1012363197 6:98408471-98408493 CTGGGAAAACTAAAGGCAGTGGG - Intergenic
1012607047 6:101170520-101170542 ATTGGAAACCAAAAAGGAGAAGG - Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1014452973 6:121603378-121603400 TTAAGAAACCAAAAGTAAGAGGG + Intergenic
1015059569 6:128946916-128946938 CTGTTAAACCAAAGGGAAAATGG + Intronic
1015729616 6:136334745-136334767 TTGGGAAGCCAGAAGGGAGATGG - Intergenic
1015757788 6:136625485-136625507 CTGTGAAACAAAAAGAAAGCTGG + Intronic
1015816077 6:137212208-137212230 CTTGGAAACCTAGAGGAAGGGGG - Intronic
1015948513 6:138527341-138527363 CTGGGAATCTAAAAGAAGGAGGG + Intronic
1016375704 6:143418462-143418484 CAGGGAAACAAAAAAGGAGAAGG + Intergenic
1016474256 6:144409479-144409501 ATGGGAAAGCACAAGGAAGGTGG - Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016967167 6:149729630-149729652 CTGGGAAAACAAAAGGTAATAGG - Intronic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017129801 6:151098478-151098500 CTTGGAAGCAGAAAGGAAGAAGG - Intronic
1017425495 6:154316312-154316334 CTGGGAAACCAAAAAAATTAAGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019849492 7:3540101-3540123 CTGGTAAACCCAAAAGAAGAGGG + Intronic
1020048823 7:5066836-5066858 CTGGGTAAACAAAACAAAGATGG + Exonic
1020105291 7:5419897-5419919 CTGAGAGACCCCAAGGAAGAGGG + Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1020678448 7:11207485-11207507 CAGGAAAACAAACAGGAAGAAGG + Intergenic
1022015245 7:26343844-26343866 CCAGGAAAGCAAAAGGAAAAAGG - Intronic
1022209252 7:28192836-28192858 CTTGGAAACAGAAGGGAAGATGG - Intergenic
1023215429 7:37857558-37857580 CAGGGAAAGGAAAAGTAAGATGG + Intronic
1023802014 7:43843386-43843408 TTGGCAAAGCAAAGGGAAGATGG - Intergenic
1024047534 7:45595384-45595406 GTTGGAAACCAATAGGCAGAAGG - Intronic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028523158 7:91753987-91754009 CAGGGAAAACAAAACCAAGATGG + Intronic
1028980608 7:96963957-96963979 TTTGGAAACAAAAAGGAAGTTGG - Intergenic
1030558389 7:111055047-111055069 CTGGGAAAAAAAAAAAAAGAAGG - Intronic
1030654291 7:112149232-112149254 CTGAGAAACCATAATGACGAAGG - Intronic
1030922252 7:115406106-115406128 CAATGAAACCAAAAGGAAAATGG - Intergenic
1031873676 7:127114026-127114048 GTGTGAAACAAAAAAGAAGATGG + Intronic
1032181690 7:129684875-129684897 CTGGGAATCCCAAAGGACTAAGG + Intronic
1032429482 7:131849316-131849338 CTAGGAGTCCAAATGGAAGACGG + Intergenic
1032657599 7:133948388-133948410 CAGGGAAATCCAAAAGAAGATGG + Intronic
1033562028 7:142541590-142541612 CTGGGAGACCAAAAGGCACACGG - Intergenic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1034847004 7:154455623-154455645 ATGGGAAATCAAAAGAGAGACGG - Intronic
1035873571 8:3162634-3162656 CTTGAAAAACAAAAGTAAGAGGG - Intronic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037500683 8:19482844-19482866 CTGGGACACATAAAGGGAGAGGG - Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038418766 8:27418521-27418543 CTGTCAAACCAAAAAGAGGAGGG - Intronic
1038547935 8:28440361-28440383 CTGGGAAACCCCAAGGATGGAGG - Intronic
1039790280 8:40870286-40870308 CTGGGCTACAGAAAGGAAGAGGG - Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1041054763 8:53973153-53973175 ATGGGAAAACAAAAGTCAGAAGG + Intronic
1042365039 8:67926192-67926214 CTTGGAATCCCAAAAGAAGAAGG + Intergenic
1042714390 8:71756607-71756629 CTGAGAAACCAAACGTTAGAAGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1043104205 8:76087841-76087863 AATGGAAACCAAAAGCAAGAAGG - Intergenic
1043572816 8:81624452-81624474 CAGTGAAACTAAAAGCAAGAAGG + Intergenic
1043598483 8:81912460-81912482 CGGGGACTCCAAAAGGAAGGAGG - Intergenic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045311177 8:101004619-101004641 GTGGCAAACCAAAAGAAAAATGG + Intergenic
1045942513 8:107755420-107755442 ATGGGAAGCCAGAAGGGAGATGG - Intergenic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046250460 8:111624234-111624256 TGGGGAAGCCAGAAGGAAGATGG + Intergenic
1047251327 8:123183580-123183602 CTGGGGATCAAAATGGAAGAGGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047447724 8:124934410-124934432 TGGGGAAACCAAAAGGAAGTAGG + Intergenic
1047819672 8:128504851-128504873 ATGGGAGACCAAAAAGGAGAAGG - Intergenic
1047947334 8:129894769-129894791 CTGGAAGAGCAAAAGGAACAAGG - Intronic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048152345 8:131905774-131905796 CTGAGAAACCAAAGGGGAGGAGG + Intronic
1048649550 8:136459845-136459867 CATGGAAGCCAAAAGGAAGGGGG + Intergenic
1049189750 8:141280471-141280493 CTGGGTAACCAAATGCAACATGG + Intronic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050582739 9:7077880-7077902 CTGAGAAACCCAAGGTAAGAGGG - Intergenic
1050704726 9:8384244-8384266 CTGGGCAACCACATGGAAGGAGG - Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053318651 9:37075634-37075656 CTGGAAAATAAAAAGGAAGGAGG + Intergenic
1054862479 9:69968075-69968097 GTGGGCAACCTAAAGTAAGAAGG - Intergenic
1055127902 9:72740157-72740179 TTGGGAAAGGAAAAGGAAAACGG + Exonic
1055355157 9:75429877-75429899 CTGGGATAGGAAAAGGCAGAGGG + Intergenic
1057202093 9:93146508-93146530 TTGGGAAACCCAAAGAAAGGTGG + Intergenic
1057682242 9:97199778-97199800 TTTTGAAACCAAAAGGAAGATGG - Intergenic
1057929297 9:99179634-99179656 TTGGGAAACCTAAACTAAGATGG + Intergenic
1057967625 9:99519416-99519438 GGGGGAATCAAAAAGGAAGAAGG + Intergenic
1058034660 9:100237614-100237636 CTGGGAAACACAAAGGATCAGGG - Intronic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1059708329 9:116844214-116844236 GTGGGACATCAAAAGGAAGAAGG - Intronic
1061318418 9:129812500-129812522 CTGGGAAGCCATAAGGCAGAGGG + Intergenic
1061700575 9:132412030-132412052 CGGGGGAAGCAAAAGGAAAAAGG - Intronic
1062355693 9:136160942-136160964 CTGACAAATCCAAAGGAAGATGG - Intergenic
1186940295 X:14499685-14499707 CTGGGACTCCAAAAGGCAGGAGG + Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187345362 X:18459002-18459024 CTGGTAAAACTAAAGGCAGAAGG - Intronic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1187471887 X:19577064-19577086 CTATGAAGCAAAAAGGAAGAAGG - Intronic
1188242964 X:27811010-27811032 CTGGGATATCAAGTGGAAGAGGG + Intronic
1188872252 X:35387544-35387566 CTTGGAAACTAAAGGCAAGAGGG - Intergenic
1189604746 X:42664794-42664816 CTGGGAAGCACAAAGGAAGCAGG + Intergenic
1189919802 X:45892272-45892294 CTGGGAAACAAATGAGAAGACGG + Intergenic
1190808589 X:53862483-53862505 CTTGGCAACCAAGAGGAAGCAGG - Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1191839189 X:65498492-65498514 CTAGGAGACCAAAAGGAAAGGGG + Intronic
1192065099 X:67875535-67875557 CTGGAAAACCTAGAGGAAGTGGG - Intergenic
1193201607 X:78697941-78697963 TAGGAAAACTAAAAGGAAGAGGG + Intergenic
1193271907 X:79538234-79538256 CTGGGAAATCAAAATCAAGTAGG - Intergenic
1193369754 X:80680575-80680597 CTGGAAAACCTTAAGGAAGGTGG + Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195519482 X:105814561-105814583 ATGGGAAGTCACAAGGAAGAAGG - Intergenic
1195965506 X:110426729-110426751 CTTAGAAAGGAAAAGGAAGACGG - Intronic
1196630527 X:117934122-117934144 CTGGGATTCTAAAAGGAGGAAGG + Intronic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1197807789 X:130414172-130414194 CTGGAATACAAAAAGGAAGCTGG - Intergenic
1198013360 X:132583169-132583191 CTGGGAACCAAGAAGCAAGAAGG + Intergenic
1198092873 X:133349265-133349287 CGGAGAAAGCAAAAGGAAGAAGG + Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201291390 Y:12423679-12423701 CTGGGACTCCATAATGAAGATGG - Intergenic
1201532580 Y:15008501-15008523 TTGGCAAACAAAAGGGAAGATGG - Intergenic