ID: 1163766301

View in Genome Browser
Species Human (GRCh38)
Location 19:19165246-19165268
Sequence CAACAGGGGGAGGCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163766291_1163766301 12 Left 1163766291 19:19165211-19165233 CCGTATCTGGGAAGACGGCCTTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG No data
1163766289_1163766301 20 Left 1163766289 19:19165203-19165225 CCACATAACCGTATCTGGGAAGA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG No data
1163766293_1163766301 -6 Left 1163766293 19:19165229-19165251 CCTTCAAGGAAGAAATTCAACAG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163766301 Original CRISPR CAACAGGGGGAGGCAGTGGA GGG Intronic
No off target data available for this crispr