ID: 1163766634

View in Genome Browser
Species Human (GRCh38)
Location 19:19166764-19166786
Sequence CTGCCCTTCTGGAAGATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163766634_1163766646 27 Left 1163766634 19:19166764-19166786 CCTTGAATCTTCCAGAAGGGCAG No data
Right 1163766646 19:19166814-19166836 AGCACTTTGGAAGGCCGAGGTGG 0: 2367
1: 94982
2: 187541
3: 136019
4: 71894
1163766634_1163766640 14 Left 1163766634 19:19166764-19166786 CCTTGAATCTTCCAGAAGGGCAG No data
Right 1163766640 19:19166801-19166823 TGCCTCTAATCCCAGCACTTTGG 0: 897
1: 102898
2: 241789
3: 242349
4: 212894
1163766634_1163766647 28 Left 1163766634 19:19166764-19166786 CCTTGAATCTTCCAGAAGGGCAG No data
Right 1163766647 19:19166815-19166837 GCACTTTGGAAGGCCGAGGTGGG 0: 1141
1: 42359
2: 191526
3: 269613
4: 181395
1163766634_1163766644 24 Left 1163766634 19:19166764-19166786 CCTTGAATCTTCCAGAAGGGCAG No data
Right 1163766644 19:19166811-19166833 CCCAGCACTTTGGAAGGCCGAGG 0: 3200
1: 124416
2: 267449
3: 211586
4: 127680
1163766634_1163766642 18 Left 1163766634 19:19166764-19166786 CCTTGAATCTTCCAGAAGGGCAG No data
Right 1163766642 19:19166805-19166827 TCTAATCCCAGCACTTTGGAAGG 0: 112
1: 13865
2: 333760
3: 263030
4: 139563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163766634 Original CRISPR CTGCCCTTCTGGAAGATTCA AGG (reversed) Intronic
No off target data available for this crispr