ID: 1163768676

View in Genome Browser
Species Human (GRCh38)
Location 19:19177842-19177864
Sequence GAGAAGAGCAGAGCCCGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 273}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163768676_1163768685 9 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768685 19:19177874-19177896 CCTTTTTTTTTTTGGTTGGGGGG 0: 1
1: 7
2: 108
3: 924
4: 4483
1163768676_1163768688 16 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768688 19:19177881-19177903 TTTTTTGGTTGGGGGGCGGCGGG 0: 1
1: 4
2: 16
3: 129
4: 820
1163768676_1163768686 12 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768686 19:19177877-19177899 TTTTTTTTTTGGTTGGGGGGCGG 0: 6
1: 65
2: 433
3: 2149
4: 9288
1163768676_1163768681 7 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768681 19:19177872-19177894 GCCCTTTTTTTTTTTGGTTGGGG 0: 1
1: 0
2: 13
3: 214
4: 1954
1163768676_1163768680 6 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768680 19:19177871-19177893 TGCCCTTTTTTTTTTTGGTTGGG 0: 1
1: 0
2: 16
3: 289
4: 2873
1163768676_1163768683 8 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768683 19:19177873-19177895 CCCTTTTTTTTTTTGGTTGGGGG 0: 1
1: 2
2: 27
3: 359
4: 2680
1163768676_1163768687 15 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768687 19:19177880-19177902 TTTTTTTGGTTGGGGGGCGGCGG 0: 1
1: 7
2: 78
3: 494
4: 2555
1163768676_1163768679 5 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768679 19:19177870-19177892 GTGCCCTTTTTTTTTTTGGTTGG 0: 1
1: 0
2: 16
3: 131
4: 1531
1163768676_1163768678 1 Left 1163768676 19:19177842-19177864 CCAAGCCGGGCTCTGCTCTTCTC 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1163768678 19:19177866-19177888 GACTGTGCCCTTTTTTTTTTTGG 0: 1
1: 0
2: 1
3: 36
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163768676 Original CRISPR GAGAAGAGCAGAGCCCGGCT TGG (reversed) Intronic
900095476 1:938387-938409 CAGAAGCCCAGAGCCTGGCTGGG + Intronic
900646714 1:3712374-3712396 GAGAAGAGCCAACCCCGGCTCGG - Intronic
901489875 1:9591234-9591256 GAGAACAGTAGAGCCCGCCCTGG - Intronic
901727921 1:11256897-11256919 GGGAGGAGCACAGCCAGGCTTGG - Intronic
903016953 1:20367384-20367406 TCGAAGAGCACAGCCCGCCTAGG + Intergenic
903775123 1:25788200-25788222 GAGAAAAGCAGAATCTGGCTGGG - Intergenic
904358139 1:29954700-29954722 GAGAAGAACAGAGACAGGGTGGG - Intergenic
904478384 1:30778811-30778833 GAGATGAGCAGAGCCCAGAGAGG + Intergenic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
906240181 1:44238033-44238055 GAGAAGAGCAGAGGCCGCGTAGG - Intronic
906510221 1:46406361-46406383 GAGAAGAGGTGAGCAGGGCTGGG + Exonic
906518584 1:46453935-46453957 GAGCAGAGCAGAGCAGAGCTGGG + Intergenic
907247387 1:53116765-53116787 CAGGACAGCAGTGCCCGGCTGGG + Intronic
910758447 1:90713974-90713996 GAGACTAGGAGAGCCCAGCTGGG - Intronic
912570548 1:110618044-110618066 GAGAAGAGCAGAGAGGGCCTGGG + Intronic
913530732 1:119732568-119732590 GAGAAGAGCTGAACTCAGCTGGG - Intronic
914514549 1:148362799-148362821 CAGAAGAGCAGAGCCGGACCGGG - Intergenic
915224958 1:154405430-154405452 GAGAGGAGCCGAGCGCGGCGCGG + Exonic
917521428 1:175751126-175751148 GGGAGGAGCAGAACCAGGCTGGG - Intergenic
917640136 1:176975400-176975422 GAGAAGAGCAGAGCAAGGTGTGG - Intronic
917738162 1:177939006-177939028 GGGTGGAGGAGAGCCCGGCTGGG - Intronic
918038452 1:180897485-180897507 GAGCAGAGCAGAGCCCTGGGGGG - Intergenic
918522016 1:185425017-185425039 GAGAAGAGCACAGGCAAGCTTGG + Intergenic
920428232 1:205896144-205896166 GAGAAGTGCAAAGACCAGCTCGG - Intergenic
920966761 1:210707479-210707501 GAGCACAGCAGAGCATGGCTTGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922748638 1:228060626-228060648 GAGCAGAGCAGAGACGGGCGGGG - Exonic
923536672 1:234857898-234857920 GAGAGGACCAGAGCTTGGCTGGG + Intergenic
1064208981 10:13347830-13347852 GAGAGGGGCAGCGCCGGGCTTGG - Intronic
1067788858 10:49272668-49272690 GAGAAGAGCAAAGCCCTGAGAGG + Intergenic
1068688657 10:59894277-59894299 GAGGAGAGCAGTGACCAGCTGGG - Intronic
1069283782 10:66688674-66688696 CATAAGAGCAGAGACCGGCCGGG + Intronic
1069715081 10:70515435-70515457 CAGCAGGGCAGAGCCAGGCTGGG - Intronic
1069814407 10:71184540-71184562 GGGAAAAGCACAGCCCGGCATGG - Intergenic
1071260946 10:83918429-83918451 GTTAAGAGCAGATCCAGGCTGGG + Intergenic
1071502288 10:86212466-86212488 GAGAGGAGCTGAGCCTTGCTGGG - Intronic
1071730861 10:88247148-88247170 GAGGAGGGCAGAGCCTGGCTTGG + Intergenic
1071997524 10:91162891-91162913 GAGGAGAGCAGAGCCCGCGGCGG - Intergenic
1072417864 10:95263937-95263959 CAGAAGAGTAGAGGCCAGCTGGG + Exonic
1073283991 10:102376235-102376257 GAGAAGGGCAGAGTCAGGGTGGG - Intronic
1073516602 10:104081534-104081556 AAGAAGAGAAGAGCCCAGTTGGG - Intronic
1074447716 10:113534052-113534074 GGGATGAGCAGAGCCTGGCTGGG + Intergenic
1075067709 10:119300795-119300817 AAGAAGTGCAGAACCTGGCTGGG + Intronic
1076014654 10:127018086-127018108 GAAAAGAGCCGAGAGCGGCTGGG + Intronic
1076477339 10:130761908-130761930 GAGAAGCTCACAGCCCAGCTAGG + Intergenic
1077177444 11:1197173-1197195 GGGAAGAGCACAGCCAGCCTCGG - Intronic
1077905238 11:6527722-6527744 GAGAAGAGAAGAGATCAGCTAGG + Intronic
1079490295 11:20981555-20981577 GAGCAGAGCAGAGCCATACTGGG + Intronic
1084044013 11:66558702-66558724 CAGAAGACCAGAGCAGGGCTGGG - Intronic
1084706590 11:70819502-70819524 GAGAAAGGCAGAGACCTGCTTGG + Intronic
1084711159 11:70844525-70844547 GTGAAGGGCAGTGCCCGGCGTGG - Intronic
1085337142 11:75704931-75704953 GAGAAGAGGAGAGGCTTGCTGGG + Intergenic
1085709085 11:78812831-78812853 GAAGAGAGCAGAGCCCAACTTGG + Intronic
1087182936 11:95157364-95157386 GAGATGTGCTGAGCCGGGCTGGG + Intergenic
1088741833 11:112773885-112773907 GAGAAGAGGAGAGCAAGGGTGGG - Intergenic
1089077486 11:115749890-115749912 GAGAAAAGCAGAGAGCAGCTTGG + Intergenic
1089156463 11:116406639-116406661 GGGATGAGCAGAGTCAGGCTTGG - Intergenic
1089312783 11:117571094-117571116 GAGACGAGCAGAGCCCTGGTGGG + Intronic
1089558900 11:119333628-119333650 GAAAAGGGCAGGGCCGGGCTTGG + Intergenic
1089702248 11:120252501-120252523 GAGAAGGGCAGAACAAGGCTGGG - Intronic
1090125461 11:124078859-124078881 GGGAAGATCAGAGTCCCGCTTGG + Intergenic
1090826635 11:130391883-130391905 AAGAAGAGCAGAGCCTGGACAGG - Intergenic
1090915770 11:131160738-131160760 GAGGAGAGCAGAGCCACTCTGGG - Intergenic
1091088397 11:132746015-132746037 GCTCAGAGCAGAGCCCTGCTGGG - Intronic
1091287089 11:134413396-134413418 GGGAAGAGCAGGGCCCGGCTTGG - Intergenic
1094005111 12:25741051-25741073 GAGAACAGCAGAGCCAGGGTTGG + Intergenic
1094166636 12:27450107-27450129 GAGAGGAGCAGAGCTGAGCTGGG - Intergenic
1096572828 12:52533607-52533629 GAGAGGTGCAGAGCCCGTCAAGG - Intergenic
1097391547 12:59021202-59021224 GAAAAGAGAAGAGCCTGGCAAGG - Intergenic
1099443731 12:82728423-82728445 GAAAACAGCAGACCCAGGCTGGG + Intronic
1103916388 12:124377981-124378003 CAGAAGAGCTGAGCGAGGCTTGG + Intronic
1106505703 13:30368906-30368928 GAGAAGAGATGGGCTCGGCTGGG - Intergenic
1107141938 13:37008463-37008485 TAGAAGAGCAGGGCCGGGCATGG + Intronic
1109998200 13:70158127-70158149 TAGAAGAGCAGAGGCTGGCGTGG + Intergenic
1111002287 13:82200369-82200391 CAGAAGACCAGAGCCAGGTTGGG - Intergenic
1112313510 13:98340944-98340966 GAGAAGAGGAGAGCTTGGCAGGG + Intronic
1112428214 13:99324410-99324432 GAGAAAAGCAGGGCCCGGAGAGG + Intronic
1112486431 13:99824562-99824584 CAGAAGAGGAGAGGCAGGCTGGG - Intronic
1112917302 13:104567308-104567330 GATAAGACCAGACCCAGGCTGGG + Intergenic
1113253831 13:108485701-108485723 GAAGAGAGCAGAGCCATGCTGGG + Intergenic
1114663638 14:24366639-24366661 GAGAAGAGCCCAGGCCGGCGGGG - Intronic
1116868553 14:50050802-50050824 CAGAAGAGTAGAGGCCAGCTGGG - Intergenic
1119028634 14:71174280-71174302 GGCAAGGGCAGAGCCAGGCTGGG - Intergenic
1121240949 14:92429734-92429756 GATAAGAGAAGAACCCAGCTTGG - Intronic
1121271144 14:92639024-92639046 TAGCAGAGCAGAGACCGCCTGGG - Intronic
1121469185 14:94138789-94138811 GAGAAGTGGAGAGCCCTGCTTGG - Intergenic
1121619513 14:95336573-95336595 GCGAAGAGCAGAGACCAGCAGGG - Intergenic
1121619525 14:95336635-95336657 GAGAAGAGCAGAGACCAGCAGGG - Intergenic
1121619554 14:95336777-95336799 GAGAAGAGCACAGACCAGCAGGG - Intergenic
1121777452 14:96599858-96599880 CAGGAGTGCAGAGCCAGGCTAGG - Intergenic
1121780346 14:96618064-96618086 GGGAAGAGGAGAGCAGGGCTGGG + Intergenic
1121791936 14:96705257-96705279 GAGAAGAGCATAGCCCGGAGAGG - Intergenic
1122293714 14:100693488-100693510 GACAAGAGCAGAGCCAGGCAGGG - Intergenic
1122459678 14:101884650-101884672 GAGCTGAGCAGAGGCTGGCTGGG - Intronic
1122609697 14:102973557-102973579 GAGAAGGGGAGGGCCTGGCTCGG + Intronic
1123015524 14:105372160-105372182 GAGGAGAGCAGGGCTCTGCTTGG + Intronic
1124025000 15:25957791-25957813 GGGAAGAGTGGACCCCGGCTGGG + Intergenic
1125576803 15:40761620-40761642 GACAAGAGCTGAGCCGGGCACGG - Intergenic
1125609095 15:40958824-40958846 GAGGAGAACAGGGCCCGGCCAGG + Intergenic
1126467693 15:48975939-48975961 GAGAAGGGCACAGCCCGGGGCGG - Intergenic
1129363527 15:75040074-75040096 TAGAAGAGAAGAGAACGGCTGGG - Intronic
1129908482 15:79206703-79206725 GAGACGAGCTGAGCCCAGCATGG + Intergenic
1131033321 15:89204688-89204710 GAGGAAAGCAGAGCCCGTCCTGG + Intergenic
1132423436 15:101693717-101693739 GACAAAAGCAGAGGCCCGCTGGG + Intronic
1132615531 16:839590-839612 GAGAAGAGCAAAGCCCCCGTGGG - Intergenic
1132787840 16:1667954-1667976 GAGAACAGATGAGCCCTGCTGGG - Exonic
1133771093 16:8867650-8867672 AAGAGGCGCAGAGCCCGGCTGGG - Intronic
1134078481 16:11308752-11308774 GAGCAAAGCAAAGCCCGGCCAGG - Intronic
1135331888 16:21567328-21567350 CAGAAGAGCAGAGCATGGGTAGG + Intergenic
1136655857 16:31708827-31708849 GAGAACAGCACAGCTCAGCTGGG - Intergenic
1138262798 16:55637351-55637373 GAGAAGAGCAAACCCAGGGTGGG + Intergenic
1139967997 16:70756201-70756223 GAGCAGAGCAGAGCAGAGCTGGG - Intronic
1140220500 16:73040312-73040334 GAGAACAGCCCAGCCAGGCTGGG + Intronic
1140521872 16:75588702-75588724 CTTAAGAGCAGAGCCCGGCCAGG - Intergenic
1141646397 16:85370240-85370262 GGGAGGGGCAGAGCCTGGCTGGG - Intergenic
1142165758 16:88586757-88586779 GAGCAGAGCAGGGCCTGGCAAGG - Intronic
1142194048 16:88731492-88731514 GAGAACAGCAGAGCCTGGAGGGG + Intronic
1142743679 17:1944360-1944382 GGGAAGAGCAGAGCTCAGTTTGG - Intronic
1144025375 17:11272250-11272272 GCAAAGAGCAGAGCATGGCTGGG - Intronic
1144098354 17:11921816-11921838 TAGCACTGCAGAGCCCGGCTGGG - Intronic
1146255661 17:31390651-31390673 GTGGAGAGAAGAGCCCGGCCGGG + Intergenic
1146278673 17:31531204-31531226 GAGAAGAGCAGTGTGGGGCTGGG + Intronic
1147667148 17:42155923-42155945 GAGAAGAGCTGACCCTGGCTAGG - Intergenic
1147757977 17:42780853-42780875 GAGACGAGAAGAGCGCGGCCGGG - Exonic
1147934731 17:44005087-44005109 GAGGTGAGCGGAGCCCGGCGTGG + Exonic
1148110981 17:45144512-45144534 GGGAGGAGCGGAGCACGGCTGGG + Intergenic
1148467755 17:47875075-47875097 GAGAAGAGAAGAAGCCGGGTGGG - Intergenic
1148523025 17:48300155-48300177 GAGAATGGCAGAGCCCTCCTTGG - Intronic
1150002655 17:61451618-61451640 GAGTGGAGCCGAGTCCGGCTCGG - Intergenic
1150474777 17:65466657-65466679 GAGAAGTGCAGAGCGAGGCAGGG + Intergenic
1150639319 17:66939001-66939023 GAGAAGAGGAGAGCACGTCTTGG + Intergenic
1151309875 17:73286406-73286428 GAGATGATCAGCGCCCCGCTGGG - Exonic
1151714500 17:75824432-75824454 GAGAAGATCTGGGCCAGGCTGGG - Exonic
1153078214 18:1190352-1190374 GAGAAGAGTAAAGCCCAGATAGG - Intergenic
1156227044 18:35119360-35119382 GAGAAAAGCAGAGCAGGGTTGGG - Intronic
1156368126 18:36448444-36448466 GAGAAGAGCAGGGCAGGGCAGGG - Intronic
1157317954 18:46609034-46609056 GAAAAAAGCAGAGCCCTCCTTGG - Intronic
1157489361 18:48111560-48111582 GAGAAGACCAGAGCCCTGGCTGG + Intronic
1159108110 18:64026774-64026796 GAGAAGCGCTAGGCCCGGCTGGG - Intergenic
1160706036 19:530873-530895 GAGGAGGGCACAGCCAGGCTCGG + Intergenic
1160755523 19:755059-755081 TAGAAGAGGAGGGCCTGGCTTGG + Intronic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1163778434 19:19232010-19232032 GAGGAGAGAAGAGACGGGCTAGG + Intronic
1163809385 19:19421153-19421175 GAGACAAGCAGGGCCTGGCTTGG + Intronic
1165766947 19:38357524-38357546 AAAAAGAGCAGAGCCAGGCGTGG + Intronic
1165803312 19:38565821-38565843 GGGAGGAAGAGAGCCCGGCTGGG + Intronic
1166804834 19:45479802-45479824 GTGAAGAGGAGATCCAGGCTAGG - Intergenic
1167011668 19:46812968-46812990 GAGAACAGGAGAGCCAGGCCAGG - Intergenic
1167423993 19:49420355-49420377 GGGAAGAGCAGAGCCAGGGCAGG + Intergenic
1167583212 19:50358626-50358648 ATGAAGAGCAGCGCCCGGGTGGG - Exonic
1167616474 19:50537049-50537071 GACAAGGCCAGAGCCAGGCTGGG + Intronic
1168078287 19:53992151-53992173 GAGAAGAACAGAGCCCTGGCTGG - Intergenic
1168142561 19:54398892-54398914 GATCTGAGCACAGCCCGGCTGGG + Intergenic
1168186214 19:54701345-54701367 GAGAAGATCAGAGTCCGACCAGG + Intergenic
1168357680 19:55712749-55712771 GAGAAGAGCAGAGGACGGGAGGG + Intronic
925391195 2:3495323-3495345 TAGAAGTGCAGAGCCTGCCTGGG + Intergenic
926135656 2:10334032-10334054 GAGAAGAGGAGAGATGGGCTTGG - Intronic
927404685 2:22754019-22754041 AAGAAGAGCAAAGCCTGGCCAGG - Intergenic
928098944 2:28423612-28423634 GAGAAGAGGGGAGCCCCTCTGGG - Intergenic
932805358 2:74778415-74778437 GAGAAAAGCAGAGCCTGGAGTGG - Intergenic
936108732 2:109647758-109647780 GAGGAGAGCCGAGCCGGGCGGGG - Intergenic
936631013 2:114202715-114202737 GAGAAGACCAGAGCCCATTTGGG + Intergenic
937038446 2:118802049-118802071 GGAAAGAGCAGGGCTCGGCTGGG - Intergenic
937366829 2:121268662-121268684 GAGAAGAGAAGAACCAGACTGGG + Intronic
937993275 2:127675505-127675527 GTGGCGAGCAGAGCCCGGGTTGG - Intronic
941929928 2:170929297-170929319 GAGCAGCGCGGAGCCCGGCTCGG + Exonic
943928429 2:193819178-193819200 GAGAAGAGCTGTGCCCCTCTGGG - Intergenic
947586485 2:231360049-231360071 GAGAAGAGGAGAGGCGGGGTGGG + Intronic
947641282 2:231709056-231709078 GGGAGGAGAAGAGCCTGGCTGGG + Intronic
948109456 2:235442954-235442976 CAGAAGAGAACAGCCAGGCTGGG - Intergenic
948574786 2:238942697-238942719 AGGAAGAGCAGAGACCAGCTGGG - Intergenic
1171360088 20:24581454-24581476 GAAAGCAGCAGAGCCAGGCTGGG - Intronic
1173149205 20:40551251-40551273 GAGAAGAGCTGAACCAGACTGGG + Intergenic
1174057858 20:47810778-47810800 CAGATGAACAGAGCCGGGCTGGG - Intergenic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1174160418 20:48546537-48546559 CAGATGAACAGAGCCAGGCTGGG + Intergenic
1175055107 20:56190894-56190916 GGGAAGACCAGAGCCCTGCATGG + Intergenic
1176416492 21:6478485-6478507 GGCAAGAGCAGAGGGCGGCTTGG - Intergenic
1178396510 21:32248073-32248095 GAGAAGACCAGAGCCGTTCTGGG - Intergenic
1179572196 21:42284406-42284428 AGCAAGAGCAGAGCCCGGCCTGG + Intronic
1179691992 21:43086820-43086842 GGCAAGAGCAGAGGGCGGCTTGG - Intergenic
1179796469 21:43787598-43787620 AAGAAGAGGAGAGGCTGGCTGGG + Intergenic
1179890553 21:44333161-44333183 TAGAAGAGCTCAGCCAGGCTGGG + Exonic
1180242227 21:46517514-46517536 GAGGAGAGCAAAGGCCGGCTGGG - Intronic
1181810395 22:25400557-25400579 GTTAAGAGCAGAGCCCAGCCGGG - Intronic
1182102764 22:27669658-27669680 CAAAAGGGCAGAGCCCGGCCTGG + Intergenic
1182785216 22:32901958-32901980 GAGGAGAGCAGAGCCCCTCTTGG + Intronic
1183231664 22:36586154-36586176 AAGAAGAGCACAGCCTGGCAGGG - Intronic
1183494472 22:38134806-38134828 GAGAGCAGCAGAGCCCTGCCAGG + Intronic
1183601129 22:38841247-38841269 GAGAAGGGCGGGGCCCTGCTTGG - Intronic
1184107487 22:42376675-42376697 CAGCAGAACAGAGCCCGGCCAGG - Intergenic
1184122485 22:42461255-42461277 CAGCAGAGCAGAGACGGGCTTGG + Intergenic
1184421516 22:44385219-44385241 GAGCAGAGCTGAGGCTGGCTGGG - Intergenic
1185011818 22:48318820-48318842 GGGAGGAGCAGAGCCTGGCGTGG - Intergenic
949502441 3:4693751-4693773 GAGAAGGGCACAGCCAGGCTGGG - Intronic
950249758 3:11454504-11454526 GAAGAGAGCTGAGCCTGGCTGGG + Intronic
952383491 3:32821869-32821891 GAGAAGAGCAGCCGCCGGCCAGG - Intronic
953966449 3:47310854-47310876 GAGAAGAGCTGAGCTCGGCCTGG - Intronic
954037214 3:47857687-47857709 GTGAAGAGCAGGGCCAGGGTGGG - Intronic
955662339 3:61314688-61314710 GAGAAGAGCACAGACAGACTAGG - Intergenic
955769322 3:62372877-62372899 GAGCTGAGCCGAGCCAGGCTGGG + Exonic
960043095 3:113170128-113170150 GAGACGAGCAGAGCTCTGCCTGG + Intergenic
960158112 3:114318373-114318395 GAGAAAGGCAGAGCCAGGCTAGG + Intergenic
961405766 3:126678731-126678753 GAGAAGGACAGAGTCTGGCTGGG + Intergenic
961652567 3:128424224-128424246 GAGAAGAGCAGACTGAGGCTTGG - Intergenic
962744485 3:138387445-138387467 GTGAGGAGCAGAGCAAGGCTTGG + Intronic
962928472 3:140016223-140016245 GAGGAGAGCTGAGACTGGCTTGG + Intronic
963041884 3:141076176-141076198 GACGAGGGCAGAGCCAGGCTCGG - Intronic
963814900 3:149818615-149818637 GAGAAGAAGAGAATCCGGCTGGG + Intronic
964630146 3:158801710-158801732 GAGAAGGGCAGCGCGCGTCTTGG + Intronic
966567162 3:181396327-181396349 GACAACAGCAGAGCAAGGCTGGG + Intergenic
968628789 4:1639588-1639610 GAGGAGGGCAGAGCCTGGCCAGG + Intronic
968935467 4:3607910-3607932 GGGAAGAGGAGGGCCAGGCTGGG + Intergenic
972625879 4:40798104-40798126 GAGAAAAGCAGAGCCGGGTGAGG - Intronic
972771588 4:42202453-42202475 GAGAAGAGCAGAGCAAGGGAGGG + Intergenic
973890246 4:55361184-55361206 CAGAAGAGCAAACCCCGGCCGGG + Intronic
974878157 4:67722400-67722422 GACAAGAGCAGAGCCCTTTTGGG + Intergenic
976509979 4:85897185-85897207 GCAAAGAGCAGGGCCAGGCTGGG - Intronic
977346570 4:95823893-95823915 GAGAAGGGCAGAGAGAGGCTAGG - Intergenic
978811940 4:112859443-112859465 GAGAGGAGCTGAGCCCAGTTAGG + Intronic
980656198 4:135790062-135790084 GACCAGAGCAGAGCCCCTCTGGG + Intergenic
980913743 4:139015924-139015946 CCGAGGAGCGGAGCCCGGCTGGG - Exonic
985636565 5:1038561-1038583 CAGAAGAGCAGAGGGCGCCTGGG - Exonic
986020700 5:3799355-3799377 GAGAGGAGCAGAGCACAGGTGGG + Intergenic
986929093 5:12795514-12795536 GCGGAGATCAGAGCCCGGCGCGG - Intergenic
988694221 5:33603567-33603589 GAGAAGAACAGACACTGGCTTGG + Intronic
991111173 5:62901226-62901248 GAGAAGATCAGAGACAGGCAGGG - Intergenic
995450181 5:112291553-112291575 GAGAAGATTAGAGTCCTGCTAGG - Intronic
995462519 5:112419150-112419172 GAGACGAGCAGCTCCCGGCGGGG + Exonic
995668718 5:114575145-114575167 GAGAAGTGCAGAGCGAGGCTGGG - Intergenic
997431982 5:133847224-133847246 GAGAAAAGTAAAGCCAGGCTAGG + Intergenic
997661182 5:135590611-135590633 GAGGAGAACAGAGACCTGCTGGG + Intergenic
998352991 5:141513309-141513331 CAGAAGAGGAGACCCCGGCGCGG + Intergenic
998781503 5:145661948-145661970 GAGATGAGCAGAGCCTGAATTGG + Intronic
999312666 5:150561835-150561857 GAAAAGGGCAGAGCCAGGCTCGG - Intergenic
1001620585 5:173081625-173081647 GAAAAGACCAGCGGCCGGCTAGG + Intronic
1001634223 5:173198250-173198272 GAGAAGAGCAAGCCCAGGCTGGG - Intergenic
1003271394 6:4610945-4610967 GAGAAGAGCAGAAACAGGGTCGG - Intergenic
1004568751 6:16824621-16824643 GAGAAGAGCACATGCCAGCTTGG - Intergenic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006984426 6:38167606-38167628 GAGAGGAGCAGACCCCTGCCTGG + Intergenic
1007270107 6:40629816-40629838 GGGAAGAGGAGAGCACGGCAAGG - Intergenic
1007302078 6:40875124-40875146 GAGAAGAGCAGACACAGGGTTGG - Intergenic
1007364635 6:41382807-41382829 GAGAAGAGCAGATGATGGCTAGG + Intergenic
1010280583 6:74018667-74018689 GTGGAGAGCAGAGCCATGCTGGG + Intergenic
1012068098 6:94576422-94576444 GAGAAGTGCAGAGCAAAGCTGGG + Intergenic
1014487071 6:122012210-122012232 CAGAACAGAAGAGCTCGGCTTGG - Intergenic
1014837291 6:126173909-126173931 CAGAAGAGCAGAGTCCTGCCTGG + Intergenic
1018049652 6:159997627-159997649 GAGAGGGGCAGAGAGCGGCTAGG - Intronic
1018937743 6:168284570-168284592 GAGAAGAGGAGGGGCTGGCTTGG + Intergenic
1019513632 7:1430265-1430287 GTGATGAGCACAGCCCGGCCGGG - Intronic
1019791034 7:3014124-3014146 GACAGGAGCAGAGCCAGGCAGGG + Intronic
1019919080 7:4151319-4151341 CAGAAGAGCAGAGGGCTGCTTGG - Intronic
1021838439 7:24703391-24703413 GAGCAGAGCTGTGCCAGGCTAGG + Intronic
1022533561 7:31081835-31081857 CAGAGGAGCAGAGCCCAGCCTGG - Intronic
1023300424 7:38764591-38764613 GGGAAGAGAAGAGCCCCGATTGG + Intronic
1023836665 7:44072674-44072696 CAGAAGCACAGAGCCTGGCTCGG + Exonic
1026603112 7:71793012-71793034 GAGAGGAGCAGAGCCGGGTGCGG + Intronic
1027151742 7:75738582-75738604 GAGAAGGGCAGAGGCGGGCTCGG - Intronic
1027336065 7:77151928-77151950 GAGAGGTGCAGAGGCTGGCTGGG - Intronic
1029779720 7:102719171-102719193 GAGAGGTGCAGAGGCTGGCTGGG + Intergenic
1031484374 7:122310430-122310452 GAGAAGTGGAGAGCCCAGCCGGG - Intronic
1031920161 7:127594557-127594579 GAGAAGTGGAGAGCCCAGGTGGG + Intronic
1035289937 7:157831426-157831448 GGGAAGAGCAGGGCAGGGCTGGG + Intronic
1035326285 7:158068069-158068091 GAGGAGAGCTGAGCCAGGGTGGG + Intronic
1035819047 8:2571906-2571928 GAGAAGAGAAGACCCCCCCTCGG - Intergenic
1036516966 8:9453196-9453218 GAGAAGAGCTGAGTACGGCTGGG + Intergenic
1038039689 8:23714404-23714426 GAGAAGCTAAGAGGCCGGCTGGG - Intergenic
1039417635 8:37409334-37409356 GACAAGAGCAGTGCCAGGCAAGG + Intergenic
1039444403 8:37619484-37619506 GAGAAGACCAAAGCCAGCCTTGG + Intergenic
1039842727 8:41305339-41305361 GAGAAGTGCAGAGCCCTCCTTGG - Intronic
1041552797 8:59119626-59119648 GAGGAGAGCACGGCCTGGCTGGG + Intergenic
1043414432 8:80033254-80033276 GAGAAGAGTTGAGCCCTTCTGGG - Intronic
1046579364 8:116072587-116072609 GAGAAGAGCAAAGGCCTCCTTGG - Intergenic
1047933535 8:129752887-129752909 GCAGAGAGCAGAGCCAGGCTGGG + Intronic
1048875347 8:138832928-138832950 GAGAAGGTTAAAGCCCGGCTCGG + Intronic
1049046838 8:140159075-140159097 GGGAAGTGGAGAGCCAGGCTGGG + Intronic
1049094799 8:140542122-140542144 GAGAACCGCAGAGCCGTGCTAGG - Intronic
1050644405 9:7703239-7703261 GAGGAGAGCAAAGCCATGCTGGG - Intergenic
1052507412 9:29373770-29373792 AGGAAGGGCAGAGCCCAGCTAGG + Intergenic
1053282474 9:36829880-36829902 GTGAAGAGCAGGTCCCAGCTGGG + Intergenic
1053445855 9:38152688-38152710 GCGAAGAGCAGAGCTGGTCTGGG - Intergenic
1054454714 9:65423946-65423968 GGGAAGAGGAGGGCCAGGCTGGG - Intergenic
1056694618 9:88836334-88836356 GAGAAGAGCAGAGCCCTGTTAGG - Intergenic
1056959191 9:91106554-91106576 GAGCAGAGCAGATCCCGACTTGG + Intergenic
1057145909 9:92759541-92759563 CAGCAGAGCAGAGCCCAGCTTGG + Intronic
1057303375 9:93899175-93899197 GGGCTGAGCAGAGCCAGGCTGGG + Intergenic
1058270573 9:102967448-102967470 GAGAAGAGCTGAGGCCCTCTGGG - Intergenic
1058767407 9:108195281-108195303 GAGAAGAGAAGAGGCCAACTCGG + Intergenic
1059102631 9:111484383-111484405 CAGAAAAGTAGAGCCGGGCTCGG + Exonic
1059228479 9:112695468-112695490 GAGAGGAGCAGAGACTAGCTAGG + Intronic
1060193882 9:121610489-121610511 GGGAAGGGCAGAGCCAGGGTTGG + Intronic
1060786220 9:126453363-126453385 GAGCAGACCAGGGCCTGGCTGGG + Intronic
1060887809 9:127167971-127167993 GAGAAGGGCAGAGCTGGGTTGGG - Intronic
1061401689 9:130371955-130371977 GAGTAGAGCAGAGGTCTGCTGGG + Intronic
1062636521 9:137494418-137494440 GTGAAGATTAGAGCCCAGCTGGG - Intronic
1185557334 X:1031750-1031772 AGGAGGAGCAGAGCCCAGCTCGG + Intergenic
1192363975 X:70455682-70455704 GAGAACAGCCGCGACCGGCTTGG + Intronic
1197989539 X:132302884-132302906 GAAAAGATCAGGGCCAGGCTGGG - Intergenic
1199737040 X:150694044-150694066 TAGAAGAGGAGAGCCCGGGTGGG - Intronic
1199826206 X:151503151-151503173 GAGAAGAGTAGGGCCAGGTTTGG + Intergenic
1200070749 X:153527872-153527894 GCGAAGAGCATTGCCCTGCTCGG + Intronic
1200942408 Y:8798841-8798863 GGGAAGAGCAGAGCGTTGCTGGG + Intergenic
1201351044 Y:13041794-13041816 GAGGAGAGCAGAGCCAGGCAGGG + Intergenic
1202019203 Y:20447879-20447901 GAGAAGAGCAGCACCAGTCTCGG + Intergenic