ID: 1163769366

View in Genome Browser
Species Human (GRCh38)
Location 19:19181355-19181377
Sequence ATGTTTTTAAAAGTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 516}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163769358_1163769366 30 Left 1163769358 19:19181302-19181324 CCAGCCCAGGGAATGTATCATGA 0: 1
1: 0
2: 1
3: 11
4: 193
Right 1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG 0: 1
1: 0
2: 3
3: 48
4: 516
1163769362_1163769366 6 Left 1163769362 19:19181326-19181348 CCCATCTCTATTTAAAGAAATAT 0: 1
1: 2
2: 70
3: 701
4: 4011
Right 1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG 0: 1
1: 0
2: 3
3: 48
4: 516
1163769363_1163769366 5 Left 1163769363 19:19181327-19181349 CCATCTCTATTTAAAGAAATATA 0: 1
1: 2
2: 73
3: 788
4: 5749
Right 1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG 0: 1
1: 0
2: 3
3: 48
4: 516
1163769360_1163769366 25 Left 1163769360 19:19181307-19181329 CCAGGGAATGTATCATGACCCCA 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG 0: 1
1: 0
2: 3
3: 48
4: 516
1163769361_1163769366 7 Left 1163769361 19:19181325-19181347 CCCCATCTCTATTTAAAGAAATA 0: 1
1: 31
2: 350
3: 2123
4: 8668
Right 1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG 0: 1
1: 0
2: 3
3: 48
4: 516
1163769359_1163769366 26 Left 1163769359 19:19181306-19181328 CCCAGGGAATGTATCATGACCCC 0: 1
1: 0
2: 1
3: 14
4: 285
Right 1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG 0: 1
1: 0
2: 3
3: 48
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163769366 Original CRISPR ATGTTTTTAAAAGTGGGACA AGG Intronic
900774183 1:4569601-4569623 TTGATTTAAAAAGTAGGACACGG + Intergenic
900890345 1:5445021-5445043 ATGTTTTTATAATTAGGCCATGG - Intergenic
901028030 1:6289405-6289427 TTGTTTTTTAAATTGAGACAAGG + Intronic
901043751 1:6382796-6382818 TTGTTTTTTAAATTGAGACAGGG - Intronic
901250679 1:7776981-7777003 ATGTTTTTAGTACTGAGACAGGG + Intronic
901331980 1:8416975-8416997 ACGTTTGTAGAAGAGGGACAAGG + Intronic
901625223 1:10620479-10620501 TTGTTTTTTAAATTGAGACAGGG - Intronic
903306776 1:22418440-22418462 ATGTGTTTCAGAGTGAGACATGG - Intergenic
904530481 1:31165429-31165451 CTGTTTTTAAAAATGGGACCTGG + Intergenic
904530901 1:31168447-31168469 AAATTTTTAAAAGTTGGGCACGG - Intergenic
905351171 1:37347544-37347566 ATTTTTTTAAAATAGAGACAGGG + Intergenic
906138202 1:43515361-43515383 TTATTTTTAAAAATAGGACAAGG - Intergenic
907802206 1:57780627-57780649 ATATTTTGAAAAGTAGGAAAAGG + Intronic
907859051 1:58333184-58333206 ACGTTTTTAGAACTGGGACTAGG - Intronic
908299082 1:62744071-62744093 ATTTTTTTAAAAATTGGCCAAGG + Intergenic
908320290 1:62972135-62972157 ATTTTTTTAAAATTGAGACAGGG + Intergenic
908753750 1:67448682-67448704 GTGTTTTATAAAGTGGGAGAAGG - Intergenic
908782835 1:67707292-67707314 CTGTGTTCTAAAGTGGGACAGGG - Intronic
908832142 1:68190168-68190190 AGCTTTTAAAAAGTGGCACAAGG + Intronic
909393666 1:75144485-75144507 ATGTTTTTAAAGGTGGTAAAGGG + Intronic
910331655 1:86079643-86079665 ATATTTTTCAAAATGAGACAAGG + Intronic
910941884 1:92545246-92545268 AATTTTTTAAAAGAGAGACAGGG + Intronic
911187086 1:94915101-94915123 ATATTTTTAAAAGGAGGAAATGG - Intronic
911194391 1:94978981-94979003 ATATTATAAAAAGTGGAACAAGG + Exonic
911496312 1:98636073-98636095 AGGTTTTCAAAAGTGGGACAAGG + Intergenic
911716223 1:101136269-101136291 ATGTTTTTAATTGTAGGAAAAGG - Intergenic
911911602 1:103644229-103644251 ATGATTATAAAAGAGGGATATGG + Intergenic
911916852 1:103707721-103707743 ATGATTATAAAAGAGGGATATGG - Intronic
911919017 1:103738367-103738389 ATGATTATAAAAGAGGGATATGG + Intronic
912576659 1:110677830-110677852 AAGTGTTTGAGAGTGGGACAAGG + Intergenic
913271403 1:117097165-117097187 ATTTTCTCAAAAGTGAGACATGG + Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
916781593 1:168036644-168036666 AAGTTTTTGAAAGAGGGTCAAGG + Intronic
916837472 1:168562277-168562299 ATGCTATTAAAAGTGGGCAAAGG + Intergenic
916968706 1:169983631-169983653 ATATGTTTAAAAATGAGACAGGG - Intronic
917763308 1:178188328-178188350 ATGTTTTGAAAACTGGTACAAGG - Intronic
918365146 1:183799627-183799649 CTGATTTTAAAAATGAGACAGGG - Intronic
918677247 1:187302701-187302723 ATGTTTTTATACATGGTACAAGG + Intergenic
919126996 1:193407168-193407190 ATTTTTTAAAAAGTGGGTGATGG - Intergenic
919352555 1:196477283-196477305 TTGTTTTAAAAAGTGAGAGAGGG + Intronic
919489289 1:198185727-198185749 ATTTTATTAAAATTGGGGCAAGG + Intronic
919600800 1:199619960-199619982 ATGTCTTAGAAAGTGGAACAAGG - Intergenic
919867953 1:201796809-201796831 CTGATTTTAAAAGTGGGCCAAGG - Intronic
920644782 1:207792920-207792942 ATGTTTTTAAAAGTGGCTTCTGG + Intronic
920887875 1:209949960-209949982 ATGCTTTTAAAAGTGGGAATTGG + Intronic
921369222 1:214404573-214404595 TTCTTTTTAAAAGTAGGAAACGG - Intronic
921543956 1:216452270-216452292 ATAGTTTTAAAAGTGGGAAGAGG - Intergenic
921931811 1:220760911-220760933 ATGCTTTTAAAAGTGTGTAACGG - Intronic
924002490 1:239569251-239569273 TTGTTTTTAAAAATGGTAAATGG + Intronic
924462666 1:244273123-244273145 ATGTTTCAAAAAGTAAGACATGG - Intergenic
1063907007 10:10791419-10791441 ATGATTTAAAAGTTGGGACATGG - Intergenic
1063964036 10:11331732-11331754 GTGGTTAAAAAAGTGGGACATGG - Exonic
1064440947 10:15353125-15353147 ATGTTTTTGAATGTGCGATAAGG - Intronic
1064751078 10:18529664-18529686 TTGTTTTAAAAAGAAGGACATGG + Intronic
1065757126 10:28941152-28941174 ATGTTTTTAAAAATTGCTCATGG + Intergenic
1065815883 10:29482203-29482225 ATTTTTTTAAATATGAGACAGGG + Intronic
1066516655 10:36169129-36169151 CAGTTTTTAAAAGTGGGCTAAGG - Intergenic
1066611448 10:37252354-37252376 TTTATTTTAAAAGTGGGAAATGG - Intronic
1067985155 10:51135785-51135807 ATGTTTTTAAAGGAGTGAAAAGG + Intronic
1068645616 10:59463443-59463465 ATATATTTGAAAGGGGGACATGG + Intergenic
1069030190 10:63588038-63588060 ATGTTTTTAAGGATGGGAAAGGG - Intronic
1069097977 10:64283232-64283254 ATTTTTTTAAAAATGGGTAAAGG + Intergenic
1069172492 10:65250842-65250864 ATATTTTGAAAAGTAGGAAATGG - Intergenic
1069447898 10:68490894-68490916 TTTTTTTTGAAACTGGGACAGGG + Intronic
1070430339 10:76331521-76331543 ATGTATTGAAAAGTGGCAAAAGG + Intronic
1072572358 10:96669879-96669901 GTGTTTAGAAAAGTGGGACCAGG + Intronic
1073581205 10:104667160-104667182 ATGTTATTAAATTTGGGACAAGG + Intronic
1073671885 10:105600184-105600206 ATGTTTTTCAGAGTGAAACAGGG - Intergenic
1073997238 10:109329660-109329682 AGGTGTTTAAAAGTGCGAAATGG - Intergenic
1074126312 10:110531170-110531192 CTTTTTTTAAAATTGAGACAGGG - Intergenic
1074699635 10:116081752-116081774 ATGTTTTCCAAAGTGGGGCTTGG + Intronic
1074782767 10:116813726-116813748 ATGTTTTTAATAGCTGGGCATGG + Intergenic
1075503275 10:122997853-122997875 ATGGTTTTAAAAGTGTCAAAAGG - Intronic
1075581501 10:123622060-123622082 ATGTTTTTATATGTGGGACATGG - Intergenic
1075909483 10:126111928-126111950 ATGTTTTTAAATTTGTGATATGG + Intronic
1076164900 10:128273725-128273747 ATGCTTTTAAAAGGGGCCCATGG + Intergenic
1076225566 10:128772173-128772195 ATGGTTTTAAAAGTGGGAGTTGG + Intergenic
1076638142 10:131896279-131896301 GTGATTTTAAAAATGGCACAGGG - Intergenic
1076755287 10:132567446-132567468 AGGTTTTTAAAAGTTGCCCAAGG - Intronic
1077968448 11:7161096-7161118 ATGTTTATAAAACTGTTACAAGG - Intergenic
1078480947 11:11674857-11674879 AAGTTTTTAAAAGTGCTACAAGG - Intergenic
1078781927 11:14447288-14447310 ATGATGTGGAAAGTGGGACATGG - Intronic
1079495340 11:21036849-21036871 ATGTTTTTAAAAATTTAACATGG - Intronic
1079693053 11:23443786-23443808 GTGTTTTTAAAAGTGAAAGAAGG - Intergenic
1081740991 11:45440499-45440521 TTGTTTTTAAAATTGACACATGG + Intergenic
1082862703 11:57871090-57871112 TTCTTTTCAAAAGTGGGAGAAGG + Intergenic
1083508153 11:63180506-63180528 CTATTTTTAAAAGTGGTAAAAGG - Intronic
1084058357 11:66652402-66652424 AAATTTTTAAAAGTGGCAAATGG + Intronic
1085179369 11:74520651-74520673 ATGTGTATAAAAGTGTGTCAGGG + Intronic
1085834543 11:79938434-79938456 GTGTTTTTTAAAGTGGGTAATGG - Intergenic
1086425059 11:86674716-86674738 TTGTTTTTTTAATTGGGACAGGG + Intergenic
1086599299 11:88612790-88612812 ATATTTTTAAAAGTGGGCGAAGG - Intronic
1087163985 11:94980347-94980369 ACTCTTATAAAAGTGGGACAAGG - Intronic
1087469785 11:98557817-98557839 TTCTTTTTAAAATTTGGACAGGG + Intergenic
1087966907 11:104426413-104426435 ATATTTTTAAGAGTGAAACAGGG - Intergenic
1088985439 11:114902093-114902115 ACTTTTTTAAAATAGGGACAGGG - Intergenic
1090453405 11:126826501-126826523 ATGTTTTAAAAAATTGGAGAAGG - Intronic
1091497632 12:986234-986256 TTGTTTTTAAAATAGAGACAGGG + Intronic
1092359791 12:7826736-7826758 ATGTTTTTACAAGTAGAATAGGG - Intronic
1094455154 12:30623913-30623935 AGTTTCTTAAAAGTGGGAGAGGG - Intergenic
1094725785 12:33114354-33114376 CTGTTTTTAAAAATGGTAGATGG - Intergenic
1095363113 12:41368096-41368118 TTGATTTTAAAAGTAGGACTGGG - Intronic
1095419185 12:42007547-42007569 ATGATTTTAAAAGTATAACAGGG - Intergenic
1095666500 12:44807523-44807545 ATGTTTTAAAAAATGGCAAAAGG + Intronic
1096291809 12:50349968-50349990 ATGATTTTTAAAATGGGAGATGG - Intronic
1096380834 12:51156604-51156626 ATGTTTTGAAAAGTCTGAGATGG + Intronic
1096731984 12:53620907-53620929 ATTTTTTAAAATGTGGGGCAAGG + Intronic
1097731588 12:63134309-63134331 TTGTTTTTAAAAAAGAGACATGG + Intergenic
1098074230 12:66710195-66710217 GTGTTTTTAAAAGTAGAAGAGGG + Intronic
1098121473 12:67244807-67244829 ATGTTTTTAAAAGTAAGGCCAGG - Intergenic
1098220077 12:68260248-68260270 ATATTTTTAAAAGTTTAACAGGG - Intergenic
1098825363 12:75289695-75289717 ATATTTTCAACAGTTGGACAAGG - Exonic
1099008896 12:77267725-77267747 CTCTTTTTAAATGTTGGACAAGG + Intergenic
1099293327 12:80799534-80799556 ATGTAATTAAAAGTGGAAGAGGG + Intronic
1099660050 12:85545920-85545942 TTATTGTTAAAAGAGGGACAAGG + Intergenic
1099719003 12:86337294-86337316 ATGTTTTTAAAGTTGGGAAGTGG + Intronic
1099924876 12:89005191-89005213 ATGTTTCTAATAGTGGGTCATGG + Intergenic
1100936887 12:99680006-99680028 ATGTCTTGAAAAGTGTGAAAGGG + Intronic
1101081724 12:101193317-101193339 ATAGGTTGAAAAGTGGGACAGGG - Intronic
1102095511 12:110237440-110237462 ATATTTTTAAAAGTAGGCGAAGG - Intergenic
1102614944 12:114145449-114145471 TTGTTTTCAAAATGGGGACAAGG - Intergenic
1102669447 12:114604917-114604939 ATCTATTTAAAAGTGGGGAAAGG - Intergenic
1103638864 12:122332013-122332035 ATATTTTTAAAGGTTGGGCACGG + Intronic
1103669533 12:122600977-122600999 CTGTTTTTAAAAGCTGCACAAGG - Intronic
1106955582 13:34935217-34935239 ATTTTTTTAAAAGTGGAATTGGG + Intergenic
1107339045 13:39386638-39386660 ATGTTTTACTAAGTGGGACTTGG + Intronic
1107646665 13:42501152-42501174 ATGTTTGTTGAAGTGGGAAAAGG + Intergenic
1107866627 13:44709610-44709632 ATGTCTATAAAATGGGGACAAGG - Intergenic
1107876035 13:44790911-44790933 ATTTTTTTAAAAGTGGCATAGGG - Intergenic
1108319048 13:49269412-49269434 ATGTTTTTAAAAGTTCCACAAGG + Intronic
1108987593 13:56612585-56612607 ATATTTTTAAAACTGTAACATGG - Intergenic
1109112854 13:58345098-58345120 ATGTTTTTAAATGTGAAATAAGG - Intergenic
1109464977 13:62719109-62719131 TTGTTTTTAAAAATGGGCCATGG + Intergenic
1109660141 13:65446857-65446879 ATGTTCATAAAAGTGAGGCAAGG - Intergenic
1110225409 13:73114468-73114490 TTCTTTTTAAAATTGAGACAGGG + Intergenic
1111107294 13:83663598-83663620 GGGTTTTTAAAAGTGGAAGATGG - Intergenic
1111502906 13:89147141-89147163 CTATTTTTAAAAGTAGAACATGG + Intergenic
1111673790 13:91361831-91361853 ATTTTTTTAAAAGTGGGCAAAGG - Intergenic
1111803954 13:93015323-93015345 AGGTTTGTAAAAGTGGGATAAGG + Intergenic
1112280068 13:98055118-98055140 ATGTTTTTAAAAGGTTAACACGG + Intergenic
1112281020 13:98063347-98063369 AGGTTTTTAAGTGTGGAACAAGG + Intergenic
1112442982 13:99438343-99438365 ATGATTTGAAAAATGGGCCAAGG + Intergenic
1112638011 13:101239004-101239026 ATGTTTTTTAAGGAGGGAAATGG - Intronic
1113102297 13:106733724-106733746 ATGTTTGTAAAAAGGGGACAGGG + Intergenic
1115839577 14:37453285-37453307 ATGGTTTTAAAAGTGAAACAGGG + Intronic
1115931186 14:38497001-38497023 AAGTTTTTAAAAATGAGACTTGG + Intergenic
1116823410 14:49647628-49647650 ATTTTTTGTAAAGAGGGACAGGG + Intronic
1117153828 14:52917528-52917550 ATTTTTTTTAAAGTGAAACAGGG - Intronic
1117392969 14:55280204-55280226 ATGTTTTAAAAAATGGGAATGGG + Intronic
1117659519 14:57988834-57988856 AGGTTTTTAAAATTTGGAGAGGG + Intergenic
1118309883 14:64684323-64684345 CTGTTTCTTAAAGTGGGACTGGG - Intergenic
1118789629 14:69078193-69078215 ATGATTTTAAAAATGGGCCAAGG + Intronic
1119518388 14:75266540-75266562 ATGTCTTTAAAAGAGAGGCAGGG - Intronic
1119571623 14:75679236-75679258 GAGTTTTTTAAAGTGGGAGAAGG + Intronic
1119867620 14:77987235-77987257 TTTTTTTTTAAATTGGGACAGGG + Intergenic
1119961048 14:78857222-78857244 ATGTCTTAAAAAGTGAGAAAAGG - Intronic
1120338292 14:83187506-83187528 TTCTTTTTAAAACTGGCACAAGG - Intergenic
1120571062 14:86116966-86116988 ATGTATTTAAAAATGTGAGAAGG + Intergenic
1120595211 14:86425799-86425821 ATACTTTTATAAGTGGGAAACGG + Intergenic
1121110670 14:91310708-91310730 ATGTTTTGAAAAGTAGACCAAGG - Intronic
1121307750 14:92917627-92917649 ATGATTTTGTAAGTGGGACGAGG + Intergenic
1122494790 14:102145446-102145468 CAGTTTTTAAAAGTTGTACATGG - Intronic
1125267809 15:37903878-37903900 ATGTTATTTAAAATGAGACATGG - Intergenic
1125823857 15:42658783-42658805 ATGTCTTTAAAAGTGCAAAAGGG - Intronic
1125987861 15:44072976-44072998 ATGTTTTTAATAGTTGGGCATGG + Intronic
1126053637 15:44709934-44709956 GAGTTTTTAAAAGGGGGAAAAGG + Intronic
1126278394 15:46913145-46913167 ATCTTTTTAAAAATGGGCAAAGG + Intergenic
1126455457 15:48856696-48856718 TTGTTTTTAAAATTGAAACAGGG + Intronic
1128433838 15:67626105-67626127 ATATTTTTAAAAGTTGGAATTGG + Intronic
1128493555 15:68175183-68175205 ATGTTTTTAAATGTCTGTCACGG + Intronic
1129039672 15:72675258-72675280 TTTTTTTTAAAAGGGAGACAAGG - Intergenic
1129375122 15:75125353-75125375 TTATTTTTAAAATTGAGACAAGG + Intergenic
1129593187 15:76936065-76936087 ATGTGTTTAAAAATGGGAATGGG - Intronic
1130275438 15:82473749-82473771 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1130467798 15:84201144-84201166 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1130496467 15:84472398-84472420 ATGTTCTTGAAAGAGGGTCACGG + Intergenic
1130590090 15:85205742-85205764 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1131237410 15:90708907-90708929 ATGTCTTTAAAAATAGGACTTGG + Intergenic
1132946664 16:2535407-2535429 ATCTTTTAAAAAGTGAAACAAGG - Intergenic
1133715544 16:8443950-8443972 ATATAATTAAAAGTGGGAGATGG + Intergenic
1133730075 16:8571190-8571212 AGGTTTTGAAAAATGGGACCTGG - Intronic
1133757977 16:8776749-8776771 ATTTTTTTAATATTGAGACATGG + Intronic
1135588050 16:23686043-23686065 ATTTTTTTAAATTTGAGACAGGG + Intronic
1136925460 16:34368647-34368669 ATGTTTTTAAAAGGGGGAGGAGG + Intergenic
1136979114 16:35043159-35043181 ATGTTTTTAAAAGGGGGAGGAGG - Intergenic
1137340063 16:47592847-47592869 ATTTTTTTAAAAAAAGGACAAGG + Intronic
1137398354 16:48133219-48133241 TTGTTTTTAAAAGTTGGAGTTGG + Intronic
1137480865 16:48850740-48850762 ATGCTTTTATAAGGGGGAGAAGG + Intergenic
1137872958 16:51968264-51968286 ATCCTCTTAAGAGTGGGACAGGG - Intergenic
1137966365 16:52937555-52937577 ACGTTTTTAAAAATCAGACATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139149063 16:64358647-64358669 ATATTTTTGAGAGTGGGACATGG + Intergenic
1139258660 16:65569377-65569399 ATTTTTTGAAGAGTGGGTCAAGG - Intergenic
1141560681 16:84865866-84865888 ATGTTTTAAAACATGGGTCATGG + Intronic
1144001902 17:11063196-11063218 AGGTTTCTAAAAGTGGAAGAGGG - Intergenic
1144255612 17:13464150-13464172 ATGGTTTTAAAAATGGGAATGGG + Intergenic
1144506526 17:15836081-15836103 ATATTTTTGAAAGTGTAACAGGG - Intergenic
1144766637 17:17736611-17736633 ATGTTTTTAGAAATGAGACATGG + Intronic
1145244555 17:21259878-21259900 AGGTTTTTAAACTTGTGACAAGG + Intergenic
1146340160 17:32011797-32011819 ATGTTTTTAAAAGTGCACAAAGG - Intronic
1146830696 17:36066632-36066654 ATGTTTTTGACAGTGAGAGAGGG + Intronic
1146981541 17:37166432-37166454 TTATTTTTAAAAGTGAGGCAGGG - Intronic
1147133257 17:38420924-38420946 TTTTTTTTAAAAGAGGGGCAGGG + Intergenic
1147299861 17:39517857-39517879 TTGTTTTTTAAATTGAGACAGGG + Intronic
1147342096 17:39758877-39758899 ATGTCTTTAAATTTAGGACACGG + Intergenic
1147442385 17:40455068-40455090 AAGTTTTTTAAATTGGGACAAGG - Intronic
1147499440 17:40948677-40948699 ATGTCTTTAAAAGTGGAAGAGGG + Intergenic
1147592169 17:41690892-41690914 AGGTTTTTAAACCTGTGACAAGG - Exonic
1147619553 17:41856288-41856310 ATTTTTTTAAATGTAGGCCATGG - Intronic
1147815647 17:43208080-43208102 GTGTTTTAATAAGGGGGACATGG + Intronic
1148295209 17:46495685-46495707 ATGTTTTTAAAAGTGCACAAAGG - Intergenic
1148522688 17:48296163-48296185 ATGTTTATTAAAGTGGGAACAGG - Intronic
1149345872 17:55734901-55734923 CTGTTTTTACAAGTAGCACAAGG + Intergenic
1150193848 17:63273284-63273306 AATTTTTTAAAAATGAGACAGGG - Intronic
1150407395 17:64914254-64914276 ATGTTTTTAAAAGTGCACAAAGG + Intronic
1151701588 17:75745559-75745581 ATTTTTTTAAAATAGAGACAGGG - Intronic
1152393841 17:80019651-80019673 AAGTTTTAAAAAATGGGCCAAGG - Intronic
1153390928 18:4558643-4558665 TTTGTTTTAAAAGTGGGACATGG - Intergenic
1154234220 18:12588592-12588614 TTTTTTTTTAAAGTGAGACAAGG - Intronic
1155632483 18:27909648-27909670 TTCTTTCTAAAATTGGGACAAGG - Intergenic
1155825577 18:30438405-30438427 ATGATTTTAAATATGGGAAAAGG - Intergenic
1155914677 18:31544768-31544790 ATTTTTTAAAAAGTAGGACTGGG + Intronic
1156100689 18:33591240-33591262 ATGTGTTAAAAAGAGGGAGAAGG - Intronic
1156884041 18:42113407-42113429 ATATTTTTAAAAGTTGGGGAGGG - Intergenic
1157549495 18:48571454-48571476 ATATTTTTAAAAGTGCTACCTGG - Intronic
1158262967 18:55629626-55629648 ATGATTCTAACAGTTGGACAAGG + Intronic
1158263845 18:55638281-55638303 ATTTTTTTTAAATTGAGACAGGG - Intronic
1158370704 18:56800033-56800055 ATGTTTTTATTTGTGGGACGGGG + Intronic
1158858112 18:61564268-61564290 ATCATTTTAAAAGAGGGCCACGG - Intergenic
1158859065 18:61574363-61574385 ATGTTTTTGATAGTTGGAGATGG - Intergenic
1159150039 18:64510214-64510236 ATGTTTTTAACAGTGGCCAATGG - Intergenic
1159741335 18:72174955-72174977 ATCTTTTTAAAAGTGTAATATGG + Intergenic
1161407768 19:4099944-4099966 ATTTTTTTAAAAGTTAGCCAAGG + Intronic
1161725709 19:5927367-5927389 ATTTTTTTTTAAGTGGGGCAGGG - Intronic
1162225914 19:9222338-9222360 ATGTTTTTACAATTTTGACAGGG + Intergenic
1162297089 19:9820847-9820869 TTTTTTTTAAATTTGGGACAGGG + Intronic
1163189074 19:15662955-15662977 ATATTTTAAAAGGTGGCACAAGG - Intergenic
1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG + Intronic
1164628829 19:29747601-29747623 ATTTTTTTAAATTTGAGACAGGG - Intergenic
1164757143 19:30698348-30698370 ATGTTAATAATAGTGGGAAATGG - Intronic
1166673877 19:44727485-44727507 ATATTTTTAAAATAGAGACAGGG - Intergenic
1167042441 19:47030480-47030502 ATATTTTTAAAAATGGGCAAAGG - Intronic
1167458735 19:49612959-49612981 ATGTCTTTAAAAGGGGGGCCAGG - Intronic
1168222135 19:54968221-54968243 TTGTTTTTAAAATAGAGACAGGG + Intronic
1168506394 19:56938975-56938997 GTGTTTTTAAAGGAGGGTCATGG + Intergenic
925240942 2:2326603-2326625 ATTATTTTAAAAGAGGTACATGG + Intronic
925368577 2:3327481-3327503 ATTTTTTTAAAAATGGAAAAGGG - Intronic
925993358 2:9271197-9271219 AGGTTTTTAAACTTGTGACAAGG + Intronic
926486613 2:13468995-13469017 ATGTTTTTGAAAATGGGAACAGG - Intergenic
926713064 2:15898642-15898664 ATATTTTTAAAGGTCGGGCATGG + Intergenic
927045232 2:19271534-19271556 AATTTTTTAAATGTTGGACAAGG + Intergenic
927432670 2:23040304-23040326 ATTTTTTAGAAAGTGGGAGAGGG - Intergenic
927785217 2:25969380-25969402 AATTTTTTAAAAGTGGGTGATGG + Intronic
927805104 2:26140091-26140113 CTGTTTCTTAAAGTGGGAGAAGG - Intergenic
928020190 2:27698509-27698531 ATATTTTTAAAAGTAGAATATGG + Intergenic
928052858 2:28018825-28018847 ATGTTTTAAAAAGTGGACTAAGG - Intronic
928144534 2:28760166-28760188 ATATTTTTAAAAATAGGAAAAGG + Intronic
928401996 2:30985729-30985751 CTGTATTGAAAAGTGGCACATGG + Intronic
929185158 2:39086392-39086414 ATGTTTTCATAAGTGGGAGAGGG + Intronic
929350359 2:40943648-40943670 ATTTTTTAAAAAGTGGTACTAGG + Intergenic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
930296850 2:49565126-49565148 AAGTCATTAAAAGTGGGACGTGG - Intergenic
930719369 2:54624396-54624418 AATTTTTTAAAAGTGGCCCAGGG + Intronic
931407618 2:61995116-61995138 ACATTTTTAAAAGAGAGACAGGG + Intronic
931764696 2:65444686-65444708 CTTTTTTTAAAATTGAGACAGGG - Intergenic
932374124 2:71219943-71219965 GTGTTTTTAAAAAAGGAACAAGG - Intronic
932514958 2:72336409-72336431 ATAATTTTAAAAGTGGGGCAAGG - Intronic
932842025 2:75092262-75092284 AGGTTTTTAAAATTGGGGGAGGG - Intronic
933712304 2:85335579-85335601 AAATTTTTAAAATTGAGACAGGG - Intergenic
933992776 2:87645512-87645534 ATGTTTTAAAAAGAGAGCCAGGG + Intergenic
934013472 2:87852159-87852181 ATGCTTTTTAAAGTGTGAAAGGG + Intergenic
934880503 2:97972740-97972762 ATGTCCTTAAAAGTGGAAGAGGG + Intronic
936301080 2:111305329-111305351 ATGTTTTAAAAAGAGAGCCAGGG - Intergenic
936530474 2:113272980-113273002 ATGTTTTAAAAAGTGGGGGCAGG - Intronic
936797311 2:116223306-116223328 ATTCTATTAAAAGTGGGAAAAGG + Intergenic
936956156 2:118024288-118024310 ATGTGTTTATGAGAGGGACACGG + Intergenic
937177545 2:119955522-119955544 ATGTTTTAAAAAGAGGGATAAGG + Intronic
937182736 2:120011184-120011206 ATGTTTTTAAAAGGTGGAGAAGG + Intergenic
938212920 2:129483649-129483671 ATTTTTTTAACAGAGGAACAGGG - Intergenic
938758499 2:134402076-134402098 AGTTGTATAAAAGTGGGACAAGG - Intronic
938959560 2:136329023-136329045 AATTTTTAAAAAGTGGGGCAGGG + Intergenic
939055436 2:137359620-137359642 CTGTTTTAAAATGTGGGTCAGGG - Intronic
939826761 2:147024585-147024607 ATTTTTTTGAAAGAGGGACAAGG + Intergenic
941613851 2:167696127-167696149 ATATGTTTAAAAGTGTGACAGGG - Intergenic
942636301 2:178010331-178010353 ATGCTATTGAACGTGGGACAAGG + Intronic
943266921 2:185743207-185743229 ATGCTTTTAAATGTGGATCATGG - Exonic
943385303 2:187196377-187196399 AACCTTTTAAAAGTGAGACATGG + Intergenic
943453765 2:188077577-188077599 ATGTTTTCTACAGTGGGTCAAGG - Intergenic
943572389 2:189588757-189588779 ATTTTTTAAAAAGTAGTACATGG - Intergenic
944252116 2:197588926-197588948 ATGGTTTTAAAAATGGGGCCAGG + Intronic
945180189 2:207083782-207083804 CGGTTCTTAAAAGTGGGAGAAGG + Intronic
945489380 2:210436916-210436938 GTGTTCTTAAAAGTAGGATAAGG + Intronic
946011876 2:216571933-216571955 ATTTTTTTAAAAAAGGGAAAAGG + Intronic
946559154 2:220892933-220892955 ATGTTTATCAAAATTGGACATGG - Intergenic
1169003596 20:2188110-2188132 TTGTTTCTTAAAGTGGAACATGG + Intergenic
1169175468 20:3508174-3508196 AAATTTTTAAAACTGAGACAAGG - Intronic
1169531586 20:6490703-6490725 ATGTTTTTAACTTTGGGGCAAGG + Intergenic
1170145151 20:13165300-13165322 ATGCTTTTATGAGTGGAACAAGG - Exonic
1170257740 20:14363953-14363975 ATGTTTTGAAAAGTGCCCCAGGG - Intronic
1170478263 20:16738541-16738563 TTGTTTTTAAAAGTAAGACTAGG + Intronic
1170852748 20:20019143-20019165 TTGTTTTTAAAAGTGGATCTAGG + Intronic
1171480176 20:25449136-25449158 ATTTTTTTAAAAGTCAGAAATGG + Intronic
1171722385 20:28577183-28577205 ATCTTTTTAAATGTGGAACTAGG - Intergenic
1171786983 20:29476623-29476645 ATCTTTTTAAATGTGGAACTAGG - Intergenic
1172322664 20:34008663-34008685 TTGTTTTTTAAATTGAGACAGGG + Intronic
1173252004 20:41368695-41368717 GTGTTTTTAAATTTGAGACAGGG + Intergenic
1173676829 20:44843366-44843388 AGGTCTTTAAAAGTGGAAGAGGG - Intergenic
1174868415 20:54160999-54161021 ATGTTTTTAAAAGTGGGCTCTGG - Intronic
1175710485 20:61216649-61216671 ATGTGTTTAAGTGTGGGAGACGG - Intergenic
1175733389 20:61369581-61369603 ATGTTTTTAGAAGAGGCACATGG + Intronic
1175810654 20:61855611-61855633 ATTTTTTAAAAAGTAAGACACGG - Intronic
1177170256 21:17647548-17647570 ACCTTTTTAAAATTGAGACAGGG + Intergenic
1177277867 21:18938905-18938927 ATGTTTTTAAAATTACTACAGGG + Intergenic
1177429388 21:20971168-20971190 ATGTTTTTTAAAATGGGGGAGGG + Intergenic
1177796208 21:25780936-25780958 GTGTTTTTAAAATAGAGACAGGG - Intergenic
1178229753 21:30768270-30768292 ATGATTTTAAAAGTTGGAGCAGG - Intergenic
1180295937 22:10935868-10935890 ATCTTTTTAAATGTGGAACTAGG - Intergenic
1180412729 22:12630135-12630157 ATCTTTTTAAATGTGGAACTAGG + Intergenic
1182023037 22:27097191-27097213 ATTTTTGTAAAATTGGAACATGG - Intergenic
1182186563 22:28409495-28409517 ACATTTTTTAAAGTGGTACAAGG - Intronic
1183139744 22:35925643-35925665 CTGTATTTAAACATGGGACATGG + Intronic
1184001953 22:41681448-41681470 ATATTTTGAAAACTGGGAAAGGG + Intronic
949115425 3:315506-315528 ATGTTTTTAAAAGTGCTCCATGG - Intronic
949438574 3:4056016-4056038 GGGTCTTTAAAAGTGGAACAGGG - Intronic
952318642 3:32255381-32255403 ATTTTTTAAAAAGTAGTACAGGG - Intronic
952376828 3:32774760-32774782 ACATTTTTAAAAGCTGGACATGG + Intergenic
952383624 3:32822946-32822968 ATTTTTTTAAAGGAAGGACAAGG + Intronic
952434495 3:33259111-33259133 ATATTTTTAAATTTGAGACAGGG + Intergenic
952488788 3:33844780-33844802 ATGTTTTTAAAATATGCACAGGG - Intronic
953576320 3:44115746-44115768 ATGTTTTTAAAAATTAGACAGGG + Intergenic
953608323 3:44426610-44426632 AAGTTTTCAAAAGAGGGAAAAGG - Intergenic
955131870 3:56177886-56177908 TTGTTTTTAAAAGTGAGAATAGG - Intronic
955713525 3:61804779-61804801 CTATTTTTAAAAGGGGGACCGGG - Intronic
955761902 3:62294491-62294513 AAGTTTTTAAAAGAGGGAGATGG + Exonic
955888384 3:63624498-63624520 ATGTCCTTAAAAGTGGAAGAGGG - Intergenic
956021322 3:64936383-64936405 ATATTTTAAAAAGTGGGGGATGG - Intergenic
956411680 3:68986058-68986080 ATTTCCTTAAAAGTGGGAGAGGG - Intronic
957349367 3:79003073-79003095 ATTTTTTTAAATGTGGGAGTGGG + Intronic
958268923 3:91473979-91474001 ATGTTGTTATAATTGGGTCAAGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
958735118 3:98000105-98000127 TTTTTTTAAAAAGTGGGAGAGGG + Intronic
959401381 3:105906089-105906111 ATATTTTTATAAGGGAGACATGG - Intergenic
959412619 3:106044309-106044331 AATTTTTTAAAAGTAGGTCAAGG + Intergenic
959944793 3:112115142-112115164 ATGCTCTGGAAAGTGGGACATGG - Intronic
960769425 3:121176250-121176272 ATTTTTTTAAAAGTGGAAATGGG + Intronic
960790296 3:121422849-121422871 ATGCCTTTAAAACTGGTACATGG - Exonic
963514954 3:146297659-146297681 ATGTAATTAAAAGTGTTACATGG + Intergenic
963665556 3:148181103-148181125 GGGTTTTTAAAAGTGGAAGAGGG - Intergenic
964121487 3:153189068-153189090 TTATTTTTAAAATTGAGACAGGG + Intergenic
964437408 3:156668931-156668953 ATATTTTTAAAACTTGGAAATGG + Intergenic
964986746 3:162751034-162751056 ATGATTTTGGAAGTGGAACACGG + Intergenic
965111194 3:164425722-164425744 TTATTTTTAAATGTGGGAAATGG + Intergenic
965660528 3:171037076-171037098 AGGCTTTTAAAAGTGGATCAAGG - Intergenic
965891084 3:173514161-173514183 ATGTTTTTAAAAGTCATACAGGG + Intronic
965949853 3:174295649-174295671 ATGTTTTGAAAAGTGATAAAAGG + Intergenic
966482051 3:180421327-180421349 AGGTCTTTTAAAGTGGAACAGGG + Intergenic
967341842 3:188407169-188407191 ATTTTTTTAATGGTGGGACAGGG - Intronic
967428734 3:189357730-189357752 ATGTATTTTAAAGTGTGACATGG + Intergenic
967487660 3:190052881-190052903 ATGAATTTGAAAGTGGCACACGG - Intronic
969989803 4:11250580-11250602 AAGTTTTTCAAAGTGGAGCATGG - Intergenic
970129474 4:12851259-12851281 TTTTTTTTAAAATTGAGACAAGG - Intergenic
970197150 4:13562447-13562469 ATCTATTTATATGTGGGACATGG + Intergenic
970739021 4:19210970-19210992 AAGTTTTTAAAAAAGGGACAGGG + Intergenic
970950011 4:21743682-21743704 ATATTTTTAAAAGTGATATATGG - Intronic
970986489 4:22165074-22165096 TTGTTTTTACAACTGGAACAAGG - Intergenic
971577594 4:28295715-28295737 ATGCTTTAAAAAGTAGGAGAGGG - Intergenic
971734903 4:30435225-30435247 ATGTTTATACAAGTGAGAGAAGG - Intergenic
972115273 4:35624412-35624434 ATTTTTTCAGAAGTGTGACATGG + Intergenic
972195875 4:36653476-36653498 AAGTCTTTAAAAGTGGGAGAGGG + Intergenic
972348490 4:38213446-38213468 TTGTTTTTAACAGTGAGAGATGG + Intergenic
972749094 4:41970793-41970815 ATATTTTTTAAATTGAGACAAGG - Intergenic
973610724 4:52634081-52634103 ATGTTTTTACAAGAGGGTAAGGG - Intronic
973846027 4:54914164-54914186 TTTCTTTTAAAAGTGGGAAAGGG - Intergenic
973930182 4:55784786-55784808 ATGTTTTTTATAGTGTGATATGG + Intergenic
974242651 4:59270972-59270994 ATTTTTTTAAAAGTATGCCAAGG + Intergenic
974272079 4:59662902-59662924 ATGTTTTCACAGGTGGGAGAAGG + Intergenic
975196073 4:71525472-71525494 AAGTTTTTAAAAATGATACATGG - Intronic
975506292 4:75142158-75142180 AAGATTTTAAAAGTGCAACAAGG + Intergenic
976549173 4:86374616-86374638 AGCTTTTTAAAAATGTGACATGG + Intronic
977042745 4:92035046-92035068 ATATTTTTAACAGTGAAACATGG + Intergenic
978825796 4:113021958-113021980 AGGTTTTAAAAAGAGGGAAATGG - Intronic
979065316 4:116124275-116124297 ATATTTTTTAAATTAGGACATGG + Intergenic
979211886 4:118114582-118114604 ATGTTATTAAACATGAGACATGG - Intronic
979919455 4:126479422-126479444 TTGTTCTTAAAAGTGCGACCCGG + Intergenic
980011212 4:127596662-127596684 ATGTTTTAAAAAGCGAGACTTGG - Intergenic
980921403 4:139089819-139089841 ATATTTCTAAAAGTGAGAAATGG - Intronic
981917617 4:150051912-150051934 ATATTTTTAAAAGTGGGGCAGGG - Intergenic
982564113 4:156967875-156967897 TTGTTTTCATAAGTGAGACAGGG + Intronic
982695280 4:158592119-158592141 ATTTTTTTAAAAGTGACATAGGG + Intronic
983073788 4:163300383-163300405 ACATTTTTAAAGGTGGGAAATGG - Intergenic
983561231 4:169103859-169103881 AAATTTTTACAAGTGGGAAAGGG - Intronic
983716844 4:170792345-170792367 ATTTTTTTAAAAGAGGAAAATGG + Intergenic
984509188 4:180658029-180658051 ATGTTTTAAAAGCTGGCACAAGG - Intergenic
987101928 5:14598549-14598571 TTGTTTGTAAAAGTGAGAAATGG + Intronic
987213329 5:15707082-15707104 ATATATTTAACATTGGGACAAGG + Intronic
987571158 5:19661661-19661683 CTCTTTTAAAAAGTGGAACAAGG + Intronic
988251416 5:28763091-28763113 AGGATTTTAAAAGTTGGTCAAGG + Intergenic
988316284 5:29633761-29633783 ATGCTTTTAGAAGAGGGACTAGG - Intergenic
988699325 5:33657682-33657704 ATGTTTATTAAAGGAGGACATGG - Intronic
989358351 5:40570641-40570663 ATGTTCTCAAGAGTGTGACATGG - Intergenic
989602100 5:43209913-43209935 ATGTTTTTAAAGGTAGCACGGGG - Intronic
990403206 5:55461186-55461208 AATTTTTTAAAACTGAGACAGGG - Intronic
990827237 5:59914645-59914667 AGGTTTTGAGAAGTGTGACATGG + Intronic
991222048 5:64227915-64227937 ATGGTTTTAAAAATGGGTAAGGG - Intronic
991317417 5:65324702-65324724 CAGTTTTTTAAAGTGGGAAAAGG + Intronic
992108075 5:73466844-73466866 ATATTTTTAAAAGTTTGGCATGG - Intergenic
993428648 5:87802315-87802337 AATTTTTTAAAAGTGGGAATTGG + Intergenic
994105874 5:95948134-95948156 ATGTTTTTAAAAATGCCATAAGG + Intronic
994172608 5:96674485-96674507 ATGTTCAAAAAAGTGGGAAAAGG - Intronic
995167051 5:109055897-109055919 CTGTTTTTAAAAATGGGCAAAGG + Intronic
996096748 5:119407319-119407341 ATGTTTTGAACAGTAGAACAAGG - Intergenic
996268194 5:121569178-121569200 ATATTTTTAAATTTGAGACAGGG - Intergenic
996317075 5:122172170-122172192 ATGTTTTTCAAAGAGGATCAGGG + Intronic
996536208 5:124580773-124580795 ATCTTGTTAAAAGCTGGACATGG - Intergenic
996851331 5:127956627-127956649 ATGTTTATAAAAGGGCAACATGG + Intergenic
997672077 5:135683473-135683495 CTGTATTTATAAGTGGGATAAGG + Intergenic
997782229 5:136670911-136670933 TTTTTTTTAAAAGTGGGCAAAGG + Intergenic
998126712 5:139628686-139628708 TTTTTTTTAAGAGAGGGACAGGG + Intergenic
998656284 5:144183500-144183522 TTATTTTTAAATATGGGACAAGG - Intronic
998987994 5:147782984-147783006 GTCTTTTTAAAAATGGGGCAAGG + Intergenic
999651270 5:153769860-153769882 ATGTATTTAAAAGTCAGGCAGGG + Intronic
1000954113 5:167522099-167522121 ATATTTTTAAAAATTGGACAGGG - Intronic
1002876505 6:1215587-1215609 TTCTTTTTAAAATTGAGACAAGG - Intergenic
1003111431 6:3254736-3254758 CAGTTTTTAAAAGAGGCACAGGG - Intronic
1004566024 6:16798527-16798549 ATGTTGTTAGAAGTGGCATAGGG - Intergenic
1005852597 6:29832947-29832969 CAGTTTTGGAAAGTGGGACATGG + Intergenic
1005876191 6:30011464-30011486 CAGTTTTGAAAAGTGGGACATGG + Intergenic
1006206733 6:32350772-32350794 AGATTTTTAAGAGTGGGAGAGGG + Intronic
1006281192 6:33054919-33054941 ATGTTATTAAAAGTTGGGAAGGG - Intergenic
1007578702 6:42942414-42942436 TTGATTTTTAAAGTAGGACAAGG + Intergenic
1008371926 6:50742368-50742390 CTGTTTTTAAAACTGCCACACGG + Intronic
1008986306 6:57547758-57547780 ATGTTGTTATAATTGGGTCAAGG + Intronic
1009174267 6:60440320-60440342 ATGTTGTTATAATTGGGTCAAGG + Intergenic
1009383851 6:63065739-63065761 ATGTTTTTCTAAGTGGGAACTGG - Intergenic
1009590672 6:65665468-65665490 ATTTTCTTAAAAATGGCACAAGG + Intronic
1009996727 6:70904090-70904112 ATGTTTTGGAAATTGGTACATGG - Intronic
1011423699 6:87203146-87203168 TTTTTTTTTAAAGTGAGACAGGG + Intronic
1011638772 6:89400376-89400398 ATGTTTTTTACTGTGGGCCAGGG + Intronic
1011951464 6:92971172-92971194 ATGTTTTGAATAGTGGCATATGG - Intergenic
1012903636 6:105037959-105037981 ATGTCTTTAAAAATGGTATAAGG - Intronic
1012916345 6:105175241-105175263 ATATTTTTAAAATTGGGGCTGGG + Intronic
1013169498 6:107623669-107623691 AAATTTTTAAAATTGGGAAAGGG + Intronic
1013489975 6:110636778-110636800 ATGTATTTTAAATTGGGAAAAGG + Intronic
1013731130 6:113168880-113168902 ACTTTTTTAAATATGGGACAAGG - Intergenic
1013785037 6:113769669-113769691 ATGTTTTTAAAAATCTCACAGGG + Intergenic
1014212059 6:118718083-118718105 ATTTTTTTAAAAAAGGGAGAGGG + Intergenic
1014892308 6:126857560-126857582 ATGTTATTAAATGTCAGACACGG + Intergenic
1015728406 6:136323320-136323342 ATGTATTTAAAAGTCTTACACGG + Intergenic
1017911311 6:158795399-158795421 ACGTTTTTAAAAGTTAGAGATGG - Intronic
1019966452 7:4502868-4502890 TTATTTTTAAAATTGAGACAGGG - Intergenic
1020762088 7:12280570-12280592 ATTTTTTTAAAATTAGGAAATGG - Intergenic
1021125283 7:16845012-16845034 AACTTTTTAAAAATGGCACAAGG - Intergenic
1021399498 7:20193689-20193711 ACATTTTACAAAGTGGGACATGG - Intronic
1021908070 7:25355369-25355391 ATGCTTTTAAAAATGATACAGGG - Intergenic
1023978219 7:45048889-45048911 GTGGTTTTAATAATGGGACAGGG + Intronic
1024294160 7:47829697-47829719 GTGTCTTTAAAACTGGGAGATGG - Intronic
1024861770 7:53852887-53852909 ATTTTTTTAAAAGAGGAAAAGGG + Intergenic
1026103099 7:67398827-67398849 ATTTTTTTAAAAGCAGGACGAGG + Intergenic
1026398811 7:69987758-69987780 ATGTTTTTAAAGTCCGGACATGG - Intronic
1026763196 7:73142037-73142059 ATGTTAATAAAAGGGGGAAATGG + Intergenic
1026887922 7:73965265-73965287 TTTTTTTTAAATGAGGGACAGGG + Intergenic
1026899808 7:74030569-74030591 ATTTTTTTTAAATTGAGACAGGG + Intronic
1026966088 7:74441026-74441048 ATTTTTTTTAAAGAGGCACAAGG - Intergenic
1027039661 7:74951821-74951843 ATGTTAATAAAAGGGGGAAATGG + Intergenic
1027083981 7:75250565-75250587 ATGTTAATAAAAGGGGGAAATGG - Intergenic
1027343634 7:77235645-77235667 ATCTTTTTAAAAATCAGACAAGG - Intronic
1027373316 7:77530312-77530334 AGATTTTTAAAAATGGCACATGG - Intergenic
1027661329 7:80991454-80991476 AATTTTTTAAAAGAGGGAAAGGG - Intergenic
1028199311 7:87942110-87942132 ATGTTCATAAAAGTGGGGCTGGG + Intronic
1028250560 7:88534849-88534871 ATTTTATTAAAAGTGGCACTAGG + Intergenic
1028272557 7:88810654-88810676 TTTTTTTTAAATGTGAGACAGGG - Intronic
1028288268 7:89031711-89031733 ATGTTTGTAAAAAAGGGACTTGG - Intronic
1029003703 7:97184391-97184413 ATATTTTTAAAAGTGGGGGTAGG - Intergenic
1029391550 7:100278336-100278358 ATGTTAATAAAAGGGGGAAATGG - Intergenic
1029886517 7:103878155-103878177 GTGTTTTAAAAAGAGGGACCAGG - Intronic
1030055111 7:105577074-105577096 GTTTTTTTAAAACTGAGACATGG - Intronic
1030129705 7:106188601-106188623 ATGTTTTTAAAAGTGGTTTTAGG + Intergenic
1030717962 7:112832947-112832969 ATTTTTTAAAAATTGAGACAAGG + Intronic
1030796581 7:113795969-113795991 ATGTTTTTAAAAGTAAAATATGG + Intergenic
1031115913 7:117668368-117668390 ATTATGTTAAAACTGGGACAGGG + Exonic
1031128048 7:117796800-117796822 ATGTTTTTATAAGTTAGATAGGG + Intronic
1031509384 7:122630271-122630293 ATGTTTTTAAAAATGTAACCTGG - Intronic
1031632505 7:124061699-124061721 ATGTCCTTAAAAGTGGAAGAGGG - Intergenic
1032065522 7:128766840-128766862 TTCTTTTATAAAGTGGGACAAGG + Intronic
1032105498 7:129025583-129025605 TTTTTTATAAAAATGGGACAGGG + Intronic
1032904905 7:136353400-136353422 ATGCTTTTAAAAGTGCAGCAAGG + Intergenic
1033350432 7:140557842-140557864 ATATTTTTAAAATAGAGACAGGG + Intronic
1033552284 7:142458324-142458346 ATGTTTGTATAAGAGGGACTGGG + Intergenic
1033554551 7:142477273-142477295 ATGTTTGTATAAGAGGGACTGGG + Intergenic
1033556826 7:142495378-142495400 ATGTTTGTATAAGAGGGACTGGG + Intergenic
1033559174 7:142514817-142514839 ATGTTTGTATAAGAGGGACTGGG + Intergenic
1033778699 7:144644117-144644139 ATGTTGTTAGAACTGGGACTGGG - Intronic
1034705006 7:153133806-153133828 ATTTTTTAAAAAGTGGGCAAAGG - Intergenic
1034926097 7:155123382-155123404 ATGTTTTTAAAAGAGGAGAAAGG - Intergenic
1035558033 8:580898-580920 ATTTTTTTAAAATTTGGAGATGG + Intergenic
1036098612 8:5752709-5752731 TTGTTGTTAAAAATGGGACTTGG + Intergenic
1037681767 8:21103609-21103631 GTATTTTTAAAAGTTGCACAGGG - Intergenic
1038652625 8:29419458-29419480 ATCTCTTAAAAATTGGGACATGG - Intergenic
1038682050 8:29677820-29677842 AAGTTTTTAAAAATGAGACATGG + Intergenic
1039277322 8:35947687-35947709 ATATATTTTAAAGTGGGGCACGG + Intergenic
1039761563 8:40582342-40582364 ATATTTTTAAAAGTCAGGCATGG + Intronic
1039928558 8:41961448-41961470 ATATTTTAAAAAGGGGGAGAGGG + Intronic
1040435267 8:47384498-47384520 ATGTTTTTAAACATGGTATAAGG - Intronic
1040910520 8:52513660-52513682 ATACATTTAAAACTGGGACATGG - Intergenic
1041349683 8:56935883-56935905 GGGTTTTTAAAAGGGGGACTTGG + Intergenic
1041608882 8:59819762-59819784 ATGTTTTAAAAAGAGAGAAATGG - Intergenic
1041667516 8:60460035-60460057 ATTTTTTTAAAATAGAGACAGGG + Intergenic
1042164470 8:65932286-65932308 ATGTTTTTAAAAATGGGGGGAGG + Intergenic
1042172595 8:66006669-66006691 ATTTTTTTAAAAGTGGGAGCAGG - Intergenic
1043111862 8:76195282-76195304 AAGTGTTTAAAAGAGGGAAATGG + Intergenic
1043192503 8:77244030-77244052 GGATTTTTGAAAGTGGGACAAGG - Intergenic
1043348378 8:79327339-79327361 AAGTTTTTATAAGTGGAAGAGGG + Intergenic
1043554047 8:81409357-81409379 AAGTTCTTAAAGGTGGAACACGG + Intergenic
1043790384 8:84459608-84459630 ATGTTTCTAACTGTGGGAAATGG + Intronic
1043974117 8:86565787-86565809 ATGTTTTGTAAAATGGGACTTGG + Intronic
1044119417 8:88376333-88376355 TTGTTTTTAAGAGAGAGACAGGG - Intergenic
1046485716 8:114885107-114885129 ATCTATTTATAAGTGGGGCATGG + Intergenic
1046762471 8:118035662-118035684 ATGTTTTTAAAGGTGCCACTGGG - Intronic
1048159622 8:132003016-132003038 ATGTTTTTAACATTGAGACGAGG + Intronic
1049952669 9:660391-660413 AGGTTTTTAAACTTGTGACAAGG - Intronic
1050961523 9:11739248-11739270 GTGTTTTTAAATCTGGAACATGG - Intergenic
1051144234 9:14009526-14009548 ATCTTTTTACAAATGGGACTTGG + Intergenic
1051996301 9:23221725-23221747 ATTTTTTTAAAAATGGGCCTTGG - Intergenic
1052047993 9:23817123-23817145 ACATTTTTAAAAGTGGGAAAGGG + Intronic
1052151379 9:25120772-25120794 ATATTTTTAAAAGAGGTTCATGG + Intergenic
1052384557 9:27808154-27808176 AAGTTTTTAAAACTTGGGCAAGG + Intergenic
1053594797 9:39548890-39548912 AAGTTCTTAAAAGTGGAAGAGGG + Intergenic
1054571456 9:66816077-66816099 AAGTTCTTAAAAGTGGAAGAGGG - Intergenic
1054978365 9:71174670-71174692 ATGTTTTTAAAAGTTTTTCATGG - Intronic
1055193279 9:73553841-73553863 ATCTTTTTAATAATGGGAGATGG - Intergenic
1055307388 9:74943866-74943888 ATATATTGAAAAGTGGGGCAAGG + Intergenic
1056725245 9:89108694-89108716 ATGTTTTTACAACTGGTGCAGGG - Intronic
1058283087 9:103142737-103142759 TTCTTTTTTAAATTGGGACATGG - Intergenic
1058713423 9:107701535-107701557 AGGTTTTACACAGTGGGACAAGG - Intergenic
1058849058 9:108993039-108993061 ATGTTTTTCAAACTGGGTGAGGG - Intronic
1059016402 9:110521134-110521156 ATGTTTTCAAAAATAAGACAAGG + Intronic
1059021125 9:110578652-110578674 GTGTTTCTAAAGGTAGGACATGG - Intronic
1061504265 9:131022254-131022276 ATTTTTTTAATAGAGAGACATGG + Intronic
1061944479 9:133901176-133901198 ATGTTCCTAAAACTGGGCCATGG - Intronic
1202802796 9_KI270720v1_random:16890-16912 ATCTTTTTAAATGTGGAACTAGG - Intergenic
1203447580 Un_GL000219v1:74100-74122 ATCTTTTTAAATGTGGAACTAGG - Intergenic
1186500766 X:10048660-10048682 AAGTATTTAAAAGTGGAATACGG + Intronic
1186770582 X:12814188-12814210 ATTTTTTTAAAAGTAGGAGTTGG - Intronic
1187295368 X:17994503-17994525 ATGTTTTTAAAAGAGAAAAAGGG + Intergenic
1187371276 X:18708969-18708991 TTGTTTTTACAAGTTGGACTTGG - Intronic
1187977445 X:24717479-24717501 ATGCTCTTACAAGTAGGACACGG - Exonic
1188284194 X:28307553-28307575 ATGTTATTAAAAATGTGATATGG - Intergenic
1188504437 X:30866439-30866461 ATGATTCTAAAACTGGGGCAGGG + Intronic
1188808181 X:34617769-34617791 CTATTTTTAAAAGGTGGACAAGG + Intergenic
1189000845 X:36943339-36943361 ATGTTTTTATAAATTGAACATGG + Intergenic
1189029991 X:37440770-37440792 ATTGTTTTAAAATTGAGACAGGG + Intronic
1189451913 X:41142464-41142486 ATGTTTTTAATATGGAGACAGGG - Intronic
1189681830 X:43525203-43525225 GTGTTTTGTAAAGTGGGAAAAGG + Intergenic
1190307523 X:49093693-49093715 ATGTTTTAAAAAGCTGGGCATGG - Intronic
1190312631 X:49127860-49127882 ATGTATTTAAAGGTGAGGCACGG + Intergenic
1190715917 X:53103487-53103509 ATGATTGTAACAGTGGGTCATGG - Intergenic
1192442912 X:71188124-71188146 CTGTTTATAAAAGTCGGGCACGG - Intergenic
1192752317 X:74005983-74006005 CTGTCTTTAAAAGGGGGAAAAGG + Intergenic
1193198609 X:78662205-78662227 CTGTTTTTCAGAGTGGGAAAAGG - Intergenic
1194309654 X:92288826-92288848 ATGTTTTTAAGAGTGTTTCATGG + Intronic
1196292285 X:113956991-113957013 GAGTCTTTAAAAGTGGGAGAGGG + Intergenic
1196502947 X:116406939-116406961 TTGTTTTCAAAAGTGGAAGAGGG - Intergenic
1199131000 X:144186310-144186332 ATGCTTTTTAAAGTGTGAAAGGG - Intergenic
1199214602 X:145250509-145250531 ATGTTTTTAAAAGCTGGAGTAGG + Intronic
1199345986 X:146740853-146740875 ATATTTACAAAAGTGGGATAGGG - Intergenic
1200617945 Y:5403093-5403115 ATGTTTTTAAGAGTGTTTCATGG + Intronic
1202368385 Y:24181986-24182008 ATGTTCTTGAAAGAGGGTCATGG + Intergenic
1202502400 Y:25488131-25488153 ATGTTCTTGAAAGAGGGTCATGG - Intergenic