ID: 1163771113

View in Genome Browser
Species Human (GRCh38)
Location 19:19192016-19192038
Sequence GTGGAGGGGCGGCCTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163771113_1163771121 9 Left 1163771113 19:19192016-19192038 CCTTTGTCAGGCCGCCCCTCCAC 0: 1
1: 0
2: 0
3: 18
4: 142
Right 1163771121 19:19192048-19192070 GCCCCCTCTGTCCCGCCCGCAGG 0: 1
1: 0
2: 2
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163771113 Original CRISPR GTGGAGGGGCGGCCTGACAA AGG (reversed) Intronic
900438416 1:2642048-2642070 CTGGAGGGGCTGGCTGACCATGG + Intronic
900780405 1:4614171-4614193 GGGGAGAGGCGGCGTGACCACGG + Intergenic
901206642 1:7501320-7501342 GAGGAAGGGAGGCCTGAGAACGG + Intronic
903822145 1:26111293-26111315 GGGGAGGTGCGGCCCGACCAAGG - Intronic
904124021 1:28223396-28223418 ATGGAAGGGTGGCCTGACATGGG + Intronic
904656602 1:32053241-32053263 CTGGAGGAGCTGCCTGAGAAAGG + Intronic
905187427 1:36206670-36206692 GTGTGGGGGCAGGCTGACAAAGG - Intergenic
906662963 1:47595441-47595463 GTGGAGGGGCTTCCTGTCTAAGG - Intergenic
907384317 1:54116111-54116133 GAGGAGAGGTGGCCTGACCAAGG - Intergenic
907651766 1:56302145-56302167 GGAGAGGAGGGGCCTGACAAGGG - Intergenic
909931570 1:81504182-81504204 TTGGGGGGGCGGCCAGAGAATGG - Intronic
911104707 1:94120698-94120720 GGGGAGGGGCGGGCAGGCAATGG + Intronic
912514123 1:110207444-110207466 GTGGAGGGGGGGCCTGGAAAGGG + Intergenic
915518884 1:156429964-156429986 GTTGAGGGGAGGCCTGGGAAGGG - Intronic
920936536 1:210440284-210440306 GTGGAAGGAGGGCCTGACAGAGG + Intronic
921377784 1:214492012-214492034 GAGGATGGGCAGCCTGAAAATGG - Intronic
922807635 1:228398861-228398883 GTGCAGGGGCGGCAGGAGAAGGG + Intronic
1063485455 10:6416348-6416370 GTGGAGGGGCTGAGGGACAAAGG - Intergenic
1072135494 10:92542006-92542028 GTGGAGGGGAGGCTGGACACAGG - Intronic
1072538754 10:96382628-96382650 CAGGAGTGGCGTCCTGACAAAGG + Intronic
1072744564 10:97930654-97930676 GTGGAGGAGCTGCCCGACCAGGG + Intronic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1075753366 10:124791775-124791797 GTGGCGGCGCGGTCGGACAAGGG - Exonic
1076767216 10:132642788-132642810 GTGGAGGGGCGGCCGCACGTGGG + Intronic
1076873563 10:133205142-133205164 GAGGAGGGGCGCCCTGAGGATGG - Intronic
1078024364 11:7680587-7680609 GGGGAGGGGCCACCTGCCAAGGG + Intergenic
1078422064 11:11220738-11220760 GTGGAGGGGCAGCGGGACCAGGG - Intergenic
1078848866 11:15145697-15145719 GAGGAAGGGTGGCTTGACAATGG - Intronic
1078910225 11:15724161-15724183 GTGGAGGGGAGGGATGTCAATGG + Intergenic
1081232485 11:40602911-40602933 GTGAAGGGGTGGCTAGACAAAGG - Intronic
1081776326 11:45678261-45678283 GTGGAGGGTGGGGCTTACAAAGG - Intergenic
1084371932 11:68750744-68750766 GGGGAGGGGCGGCCAGGAAAGGG + Intronic
1090708552 11:129363555-129363577 GTGGAGGGTCTGGCTGAAAAAGG - Intergenic
1091281377 11:134383610-134383632 GTGGAGGGGCTTCCCGAGAAGGG - Intronic
1095923639 12:47556670-47556692 GTGGAGAGGGGGCCTGAAAGAGG - Intergenic
1100351676 12:93789600-93789622 GTGGAAGGGAGGGATGACAAAGG + Intronic
1100593018 12:96046773-96046795 GTGGGGGGGTGGGCTGGCAAGGG - Intergenic
1105041677 12:132966230-132966252 GTGGAAGGACGGCCTAAGAACGG + Intergenic
1108301610 13:49082942-49082964 GTGGAGGGGTAGCCTGACCTGGG + Intronic
1109213860 13:59565351-59565373 GTGGATGGGAGGCCAGAAAATGG - Intergenic
1118740625 14:68737022-68737044 GTGGAGTGGTGGCCTGGCACAGG - Intergenic
1120686514 14:87544049-87544071 ATGGAGGAGCTGCCTGAGAAGGG + Intergenic
1122803876 14:104247099-104247121 CTGGAGGGGCGGACTCTCAAAGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123028666 14:105440363-105440385 GTGGAGGGGCGGCCGGCAGATGG + Intronic
1124121795 15:26894333-26894355 GTGCAGGCGCGGCCTGTGAAGGG - Intronic
1128743840 15:70100288-70100310 GAGGAGGGGTGGCCTGTGAAAGG + Intergenic
1129331018 15:74827084-74827106 GGGGAGGGGCGACCGGACGAGGG + Intronic
1129592812 15:76932081-76932103 TGGCAGGGGCGGCCTGACAATGG + Intronic
1130715231 15:86327213-86327235 GTGGAGGGTGTGCATGACAAGGG + Intronic
1131889429 15:96956442-96956464 CTAGAGGGGAGGCCTGGCAAGGG + Intergenic
1138186624 16:54982376-54982398 GTGGAGGGCGGGGCTGAGAATGG - Intergenic
1141831367 16:86511464-86511486 GTGGAGAGGCTGCCGGACAGGGG - Exonic
1143088777 17:4436152-4436174 GGAGAGGTGCGGCCAGACAAGGG + Intronic
1144024440 17:11265408-11265430 GTGGAAGTGTGGCCTGAGAATGG + Intronic
1146796441 17:35784625-35784647 GAGGAGTGGCAGCATGACAAAGG + Intronic
1147558488 17:41494902-41494924 GTGGAGGGGCAGCCAGGCAGTGG - Intergenic
1148089314 17:45013306-45013328 AGGGAGGGGCGGCCTCAAAAGGG + Intergenic
1148756850 17:49977693-49977715 GAGGAGGGGCAGCCTGTCACTGG - Intergenic
1151852050 17:76696765-76696787 GTGAAGGTGCGGCCAGCCAAAGG + Intronic
1152626365 17:81389547-81389569 CTGGAGGGGCAGCAGGACAATGG + Intergenic
1152703110 17:81829222-81829244 GGGGAGTGGCGGCCTGACCGAGG + Intronic
1152820206 17:82433966-82433988 GTGGATGGGCGGCCTGGCACGGG + Intronic
1152820227 17:82434049-82434071 GTGGATGGGCGGCCTGGCACGGG + Intronic
1161203434 19:3028588-3028610 TTGGAGGGGGGGCGCGACAAAGG - Intronic
1161583728 19:5094121-5094143 GAGGAGGGGCCGCGTGACCATGG - Intronic
1163368629 19:16889728-16889750 GTGGTGGGGCTGCCGGCCAATGG + Exonic
1163771113 19:19192016-19192038 GTGGAGGGGCGGCCTGACAAAGG - Intronic
1164589134 19:29496469-29496491 GTGGAGGGGATGCCTGCCAGTGG + Intergenic
1167665494 19:50820976-50820998 GAGGAGGGGAGGCCTGAGAGCGG + Intronic
929437656 2:41940647-41940669 GTGGAAGGGCTGCCTATCAATGG + Intronic
931685142 2:64785987-64786009 GTGGAGGGGCTGTATGACAAGGG + Intergenic
931757316 2:65385518-65385540 GTGGAGGGGAGGCGTGGCAGAGG + Intronic
932081268 2:68717521-68717543 GTGGAGTTGAGGCTTGACAAGGG + Intronic
935347421 2:102121422-102121444 GTGGAGGAGCAGCCTGGAAATGG - Intronic
940823839 2:158387701-158387723 ATGGAGGGACAGCCTGACATGGG - Intronic
940823857 2:158387820-158387842 GTGTAAGGGCGGCCTGATATGGG - Intronic
940913367 2:159228515-159228537 GTGGAGGGGCAGCCTCAGAGAGG - Intronic
945051453 2:205827952-205827974 ATGGCAGGACGGCCTGACAAGGG + Intergenic
946457294 2:219837814-219837836 GTGGAGGGTCAGCCTGCCATCGG - Intergenic
946622432 2:221573549-221573571 GAGGAGGGGCGGCCTGGGAAGGG - Intronic
947699245 2:232218580-232218602 CTGGAGGGGCAGCAGGACAAGGG + Intronic
948637465 2:239348706-239348728 GTGGAGGGCTGGCCGGGCAAGGG + Intronic
948844065 2:240674829-240674851 GTGGAGGGGCAGCCTCAGAGAGG + Intergenic
1173515865 20:43665397-43665419 GTGCAGTGGCGGGATGACAAGGG + Intergenic
1176230509 20:64030341-64030363 GTGGAGGGGAAGCCGGACACAGG - Intronic
1176310203 21:5145279-5145301 GCGGAGAGGAGGCCTCACAAGGG + Intronic
1179846853 21:44116757-44116779 GCGGAGAGGAGGCCTCACAAGGG - Intronic
1180875837 22:19174970-19174992 GAGGTGGGGCTGCCTGACCAGGG - Intergenic
1180975695 22:19846889-19846911 CTGCTGGGGCTGCCTGACAAAGG - Exonic
1181034769 22:20164635-20164657 TTGGAGGGGATGCCTGACAAAGG + Intergenic
1181509047 22:23380724-23380746 TTGGAGGGGTTGCCTGACAAAGG - Intergenic
1183324683 22:37184807-37184829 GTGGAGGAGCCTCCTGGCAAAGG - Intronic
1183590267 22:38775813-38775835 GTGCAGGGGAGGCCTGGCGATGG + Intronic
1184127858 22:42500529-42500551 GTGGAGGTGTGGCCTGACTGGGG + Intergenic
1184129049 22:42506466-42506488 GGGGAGGGGCAGGATGACAAAGG + Intergenic
1184138996 22:42566780-42566802 GGGGAGGGGCAGGATGACAAAGG + Intronic
1184341645 22:43889483-43889505 GTGGAGGGGCAGTCTGCAAAGGG + Exonic
949188097 3:1218183-1218205 GTGGTGGGGTGGCCTGGCAGAGG + Intronic
954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG + Intronic
960615437 3:119591857-119591879 GTGGGGGAGCTGCCTGAGAAGGG - Intergenic
961570993 3:127798741-127798763 GTGGAGGAGAGGCCACACAAAGG - Intronic
961604516 3:128083678-128083700 GTGGAGGGGCTGCCTCCCCAGGG - Intronic
961676292 3:128568970-128568992 GGGCAGGGGCGGCCTGGGAATGG + Intergenic
961796709 3:129414359-129414381 GTGGAGGGGTTTCCTAACAATGG - Intronic
968621921 4:1607565-1607587 GTGGGGGGGCGGCCTCACTTAGG - Intergenic
969113345 4:4857033-4857055 GGGGGCGGGCGGCCTGAAAAGGG - Intergenic
974318210 4:60309487-60309509 GTGGAGGCCCTGCTTGACAAAGG - Intergenic
984756741 4:183331662-183331684 GTGGAGGGGAGGCCTGCCGTGGG + Intergenic
985678709 5:1245128-1245150 GGGGACGGGCAGCCGGACAACGG + Intronic
985755017 5:1708722-1708744 GGGCAGGGGCCGCCTGACAGTGG - Intergenic
985872779 5:2570454-2570476 GTGGAGGTGGGGCCTGGGAAGGG - Intergenic
986610780 5:9565039-9565061 GTGGATGGGAGGCATGAAAAAGG + Intergenic
990231018 5:53712819-53712841 CTGGAGGGGTGGGCTCACAAGGG + Intergenic
993170235 5:84410181-84410203 GTGGAGGGGAAGCCTGATAGGGG + Intergenic
997564908 5:134879618-134879640 GTGGAGGGGCGGGATCACATTGG - Intronic
998416047 5:141946653-141946675 GGGGAGGGGCTGCCTGTCCAAGG + Intronic
1001997685 5:176175119-176175141 GTGCAGGGGCGGCATGACCAGGG - Intergenic
1003058489 6:2843320-2843342 CAGGAAGGGTGGCCTGACAAGGG + Intergenic
1007340713 6:41189797-41189819 GTGGAGAGGAGGCCTGAAAGAGG + Intergenic
1007793299 6:44326527-44326549 GTGGAGGCGGGGCCTGGCCAGGG + Intronic
1008664983 6:53707209-53707231 GTCGTGGGGCGGCCTGAGGATGG - Intergenic
1009611214 6:65943773-65943795 GTGGAGTGGAGGCTTGCCAAGGG - Intergenic
1013315787 6:108941447-108941469 GTGGAGGCATGTCCTGACAAAGG + Intronic
1018174652 6:161168159-161168181 CTGGCAGGGCAGCCTGACAAAGG + Intronic
1018702258 6:166436525-166436547 GGGGAGGTGCGCCCTGACAGGGG + Intronic
1018941835 6:168313669-168313691 GTTGAGGTGTGGCCTCACAAAGG - Intronic
1019200264 6:170308043-170308065 GTGAAGGGGAGGCCAGAGAAAGG - Intronic
1019396628 7:823501-823523 GTGGAGGAGCGGCATGTAAATGG + Intronic
1019729208 7:2621238-2621260 CTGGAGGGGAGGCCAGACGAGGG - Intergenic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1026468436 7:70674175-70674197 GGGGAGGGGGGCCCTGAGAAAGG + Intronic
1027050129 7:75016568-75016590 GTGGAGGGGAGGCCAGGAAAAGG - Intronic
1029087328 7:98021787-98021809 GTGGAGGCCCGGCCTGAAAACGG - Intergenic
1029382906 7:100225100-100225122 GTGGAGGGGAGGCCAGGAAAAGG + Intronic
1029813116 7:103069061-103069083 GTGGTGGGGCGGCCGGGCAGAGG - Intronic
1034893103 7:154857809-154857831 GTGAAGTGCTGGCCTGACAATGG - Intronic
1039153065 8:34528554-34528576 CAGGAGGGGCGGCCTGGCAGAGG + Intergenic
1039882363 8:41632912-41632934 GGGTAGGGGCGGACTGACTAGGG - Intergenic
1040328995 8:46376451-46376473 GGGGAGAAGCGGCGTGACAACGG + Intergenic
1040590608 8:48789137-48789159 CTGGAGGGGCCACCTTACAAGGG - Intergenic
1045067995 8:98469257-98469279 GCGGGGGGGCGGTCTGAGAATGG + Intronic
1047765716 8:127988318-127988340 ATGGTGGGGGGGCCTGAAAAGGG + Intergenic
1049238081 8:141522724-141522746 GAGGAGGGGTGGCCAGACAAGGG - Intergenic
1049644343 8:143729373-143729395 GTGGAGGGGAGGCTGGACAATGG - Intronic
1053575255 9:39353488-39353510 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1053839759 9:42181422-42181444 GTGGAGGGCAAGCCAGACAATGG - Intergenic
1054096817 9:60912171-60912193 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1054118221 9:61187797-61187819 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1054589534 9:66994767-66994789 GTGGAGGGCAGGCCAGACAATGG + Intergenic
1057695519 9:97320363-97320385 GAGGAGGGGAGGCCTTAGAAGGG - Intronic
1060301587 9:122377455-122377477 GTGGGGGGGCGGTCAGAAAAGGG - Intronic
1061207137 9:129171291-129171313 GGGGAGGGGAGGCCGAACAAGGG - Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062436237 9:136547728-136547750 GCGGAGGGGCGGCCTGGGAGGGG + Intergenic
1062506943 9:136882429-136882451 CTGGAGGGGCGGCATGACCATGG - Intronic
1190629217 X:52368774-52368796 GTGGTGGGGGTGCCGGACAAGGG + Intergenic
1192263811 X:69525054-69525076 GGGGAGGGGTGGCCTGACATTGG - Intronic
1200091424 X:153637864-153637886 GCGGAGGGGCGCCCTGGCCATGG + Intergenic
1201886176 Y:18884793-18884815 GTGGAGGGTAGGCCTGAAAGAGG + Intergenic