ID: 1163772127

View in Genome Browser
Species Human (GRCh38)
Location 19:19197575-19197597
Sequence CTCAATCTCTCCAAAGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163772127_1163772135 21 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772135 19:19197619-19197641 TGGGTGCGTCCCAGCCCAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 209
1163772127_1163772136 22 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772136 19:19197620-19197642 GGGTGCGTCCCAGCCCAGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 200
1163772127_1163772132 1 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772132 19:19197599-19197621 CCGTTCGCTTCCTGCTGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1163772127_1163772137 29 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772137 19:19197627-19197649 TCCCAGCCCAGCTGGGCAGCTGG 0: 1
1: 0
2: 3
3: 66
4: 511
1163772127_1163772133 2 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772133 19:19197600-19197622 CGTTCGCTTCCTGCTGGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1163772127_1163772139 30 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772139 19:19197628-19197650 CCCAGCCCAGCTGGGCAGCTGGG 0: 1
1: 0
2: 3
3: 45
4: 523
1163772127_1163772130 -4 Left 1163772127 19:19197575-19197597 CCTCCGCCTTTGGAGAGATTGAG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1163772130 19:19197594-19197616 TGAGACCGTTCGCTTCCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163772127 Original CRISPR CTCAATCTCTCCAAAGGCGG AGG (reversed) Exonic
901881971 1:12199348-12199370 CTCCATCTCTCCAAAACTGGGGG + Intronic
905155770 1:35979330-35979352 CTCATTCTGTCCCAAGGCTGGGG - Intronic
910235384 1:85030523-85030545 CTGAATCTCTGAAAAGGTGGGGG + Intronic
911106208 1:94133964-94133986 CTTAATCTCTCCAGAGCTGGGGG - Intergenic
911345069 1:96686886-96686908 TTCCATCTTTCCAAAGGCAGAGG - Intergenic
912474625 1:109927711-109927733 CTCAATCTCTCCAAGGCCACTGG - Intronic
912942182 1:114055176-114055198 TTTAATCTCTCCCAAGGCAGAGG + Intergenic
913086338 1:115440621-115440643 CTTAATCTCTAGAAAGGAGGTGG + Intergenic
918364644 1:183794755-183794777 CTCTATTTCTTCAAAGGTGGTGG + Intronic
920759667 1:208770452-208770474 CTCAATCTCTCAAAGGGCCACGG + Intergenic
921429858 1:215052998-215053020 CTCATTTTCTCCAAAGTCAGAGG + Intronic
1064245779 10:13666637-13666659 CTGAATCTCTCCAAAGGCTTTGG - Intronic
1064645091 10:17453228-17453250 CTGCTTCTCTCCAAAGGTGGCGG + Intronic
1065864429 10:29901575-29901597 CTCAGTTACTCCAAAGGCTGAGG + Intergenic
1067542419 10:47165683-47165705 CTGAATCTCTGCAGAGGCCGGGG - Intergenic
1068910684 10:62375041-62375063 CTCAACCTCTTCAAAAGCAGAGG - Intronic
1070359442 10:75672821-75672843 CTCAATCTCTCAAAGTGCTGGGG + Intronic
1071120923 10:82277901-82277923 CCAAAGCTCTCCAAAGGCTGAGG - Intronic
1071573302 10:86709683-86709705 CTCCCTCTCTCCAAAGGCGGTGG + Intronic
1071823296 10:89299384-89299406 ATCAGTATCTCCAAAGGCGAAGG + Intronic
1073352688 10:102831120-102831142 CTGTATCTCTCCCCAGGCGGGGG - Intronic
1075327252 10:121543824-121543846 CTGGATCTCTCCAGAGGAGGTGG + Intronic
1083237285 11:61359378-61359400 CTCAATTCCTCCAAGGGCAGAGG + Intronic
1083698554 11:64458599-64458621 CTCCATCTCACTAAAGGCTGAGG - Intergenic
1086118954 11:83285926-83285948 CTCTTTCTCTCCCAAGGCAGAGG - Exonic
1097753595 12:63384875-63384897 CTCAATCTCTCCACAGATTGAGG + Intergenic
1097772260 12:63601557-63601579 CTCATTCTCTGCAAAGGCTTAGG - Intronic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102849124 12:116222362-116222384 CTCTACCTCTCCATAGGCGAAGG + Intronic
1112632685 13:101179848-101179870 CACACTCTCTCCAAAGGCCACGG + Intronic
1113417412 13:110138853-110138875 CTCCATCCCTCCAGAGGCCGGGG + Intergenic
1119808265 14:77496955-77496977 CTGAAACCCTCCAAAGGCCGTGG - Intronic
1120156959 14:81104124-81104146 CTCAAGCTCTCAATAGGCAGAGG - Intronic
1121779139 14:96610654-96610676 CTCAATCTCCCCAAAGTCCCAGG + Intergenic
1202940660 14_KI270725v1_random:142985-143007 CTCAGTCTCCCCAATGGCTGGGG - Intergenic
1124532511 15:30519972-30519994 CTCTATATCTTCAAAGGAGGTGG - Intergenic
1124766142 15:32487672-32487694 CTCTATATCTTCAAAGGAGGTGG + Intergenic
1125516786 15:40324912-40324934 CTGAAGCTCTCGAAAGGAGGAGG + Intergenic
1131655041 15:94447508-94447530 CTCAACTACTCCAGAGGCGGAGG - Intronic
1134166426 16:11933705-11933727 CTCACTCTCACCAAGGGCTGAGG - Exonic
1134494287 16:14720024-14720046 CTCACTCTCACCAAGGGCTGAGG + Intronic
1134499668 16:14759144-14759166 CTCACTCTCACCAAGGGCTGAGG + Intronic
1134526216 16:14945771-14945793 CTCACTCTCACCAAGGGCTGAGG + Intronic
1134580908 16:15369900-15369922 CTCACTCTCACCAAGGGCTGAGG - Intronic
1134713794 16:16344242-16344264 CTCACTCTCACCAAGGGCTGAGG + Intergenic
1134953023 16:18364415-18364437 CTCACTCTCACCAAGGGCTGAGG - Intergenic
1135311817 16:21411122-21411144 CTCACTCTCACCAAGGGCTGAGG - Intronic
1135364767 16:21843574-21843596 CTCACTCTCACCAAGGGCTGAGG - Exonic
1135447074 16:22527763-22527785 CTCACTCTCACCAAGGGCTGAGG + Exonic
1136150986 16:28349022-28349044 CTCACTCTCACCAAGGGCTGAGG - Exonic
1136167220 16:28462862-28462884 CTCACTCTCACCAAGGGCTGAGG - Exonic
1136195757 16:28652154-28652176 CTCACTCTCACCAAGGGCTGAGG + Exonic
1136212095 16:28766279-28766301 CTCACTCTCACCAAGGGCTGAGG + Exonic
1136256814 16:29046207-29046229 CTCACTCTCACCAAGGGCTGAGG + Exonic
1136308521 16:29390129-29390151 CTCACTCTCACCAAGGGCTGAGG - Exonic
1136321936 16:29491655-29491677 CTCACTCTCACCAAGGGCTGAGG - Exonic
1136436617 16:30231628-30231650 CTCACTCTCACCAAGGGCTGAGG - Exonic
1140366506 16:74385539-74385561 CTCACTCTCACCAAGGGCTGAGG + Exonic
1143439644 17:6959542-6959564 TTCAATCTCTCCACAGGGGAAGG + Intronic
1144186038 17:12795834-12795856 CACAAGCTTCCCAAAGGCGGTGG - Intronic
1151378841 17:73710770-73710792 GCCCACCTCTCCAAAGGCGGTGG - Intergenic
1152241437 17:79163353-79163375 CTCAGTTTCTCCAAAGGCTTGGG - Intronic
1154117694 18:11625764-11625786 CTCACTCTCACCAAGGGCTGAGG - Intergenic
1157307864 18:46530131-46530153 CTCAAAATCTCCAAAGACAGAGG - Intronic
1158391170 18:57046450-57046472 ATCTATCTCTCCAAAGGGGAAGG - Intergenic
1162262757 19:9546008-9546030 CTCAAACTCTACAAACTCGGTGG + Intergenic
1163772127 19:19197575-19197597 CTCAATCTCTCCAAAGGCGGAGG - Exonic
1165831806 19:38734236-38734258 GTCAATCTCTCCAGAAGGGGAGG + Intronic
1168673969 19:58263427-58263449 CTCAATCTCTCACAAGGCAGCGG - Exonic
925591707 2:5516364-5516386 CTCAATTTCTCAAAATGCTGGGG + Intergenic
928102768 2:28449159-28449181 CTCAATCTCTCCATCGTCAGGGG + Intergenic
928905675 2:36365015-36365037 CTAAATCTCTTCAAAGGGGTGGG + Intronic
930441246 2:51409669-51409691 CTCAATTTCTACCAAGGAGGAGG + Intergenic
934050390 2:88205773-88205795 CTCAATTTCTACAAAGGCCCAGG - Intergenic
934110145 2:88734594-88734616 CTCAATCTCATCAAGGGTGGCGG + Exonic
934973862 2:98786577-98786599 CTCCATCTCTCCCAAGGAGGGGG - Intergenic
943673587 2:190693650-190693672 CTAAATCTGTCAAAAGGCAGCGG + Intergenic
944756776 2:202770985-202771007 CTCAACCTCTTTAAAGGTGGGGG - Intergenic
945827138 2:214735817-214735839 CTCCATCTCTCCAAAAGCAGAGG + Intronic
947430607 2:230024442-230024464 CTTAATCTCTGCAAAGTGGGAGG - Intergenic
947927867 2:233937460-233937482 CTGAATATCCCCAAAGGCGTCGG - Exonic
1174406043 20:50304095-50304117 CTCATTTTCTCCAAAGTCGTGGG - Intergenic
1175506511 20:59489265-59489287 TTAATTCTCTCCAAAGGCGTAGG + Intergenic
1176582492 21:8543957-8543979 CTCAGTCTCCCCAATGGCTGGGG + Intergenic
1179845170 21:44107164-44107186 CCCAACCCCTCCCAAGGCGGGGG - Intergenic
1180265324 22:10521005-10521027 CTCAGTCTCCCCAATGGCTGGGG + Intergenic
1185101820 22:48844671-48844693 CTCCAACTCGCCAAAGGCTGAGG + Intronic
953177943 3:40568783-40568805 ATCAATCTCTCCAAAGGCTCAGG + Intronic
954244380 3:49319077-49319099 CGCAATCCCTCCCAAGGTGGTGG - Intronic
960183928 3:114615721-114615743 CTCAATCACTCCAGAGGCTGAGG - Intronic
962877800 3:139549241-139549263 CTCTATCTCTCCAGAGGCACTGG - Intergenic
963474841 3:145791842-145791864 CTCAAACTCTCCAGAGGTTGTGG + Intergenic
966344909 3:178968508-178968530 CCCAACCTCTCCACAGGCAGGGG + Intergenic
968990397 4:3907346-3907368 CTCAACCTCCCCAAATGCTGGGG + Intergenic
969362874 4:6676206-6676228 CTTCACCTCTCCAAAGGCTGGGG - Intergenic
976184421 4:82430270-82430292 CTGTATCTATGCAAAGGCGGAGG + Intergenic
977955783 4:103024045-103024067 CTCAATCAATCCAAGGGTGGTGG - Intronic
980433918 4:132743501-132743523 CTGTATATCTCCAAAGGAGGAGG - Intergenic
992097832 5:73379566-73379588 GTCCATCTTTCCAAAGGCAGAGG - Intergenic
992245073 5:74812528-74812550 CTCAGTTACTCCAAAGGCTGAGG - Intronic
1005528175 6:26673206-26673228 CTCATTCTCTGCAAAGAAGGAGG - Intergenic
1005530938 6:26705221-26705243 CTCATTCTCTGCAAAGAAGGAGG - Intergenic
1005539858 6:26796415-26796437 CTCATTCTCTGCAAAGAAGGAGG + Intergenic
1005542620 6:26828433-26828455 CTCATTCTCTGCAAAGAAGGAGG + Intergenic
1009010675 6:57838556-57838578 CTCATTCTCTGCAAAGAAGGAGG + Intergenic
1009012260 6:57856604-57856626 CTCATTCTCTGCAAAGAAGGAGG + Intergenic
1009013435 6:57870550-57870572 CTCATTCTCTGCAAAGAAGGAGG + Intergenic
1009550243 6:65082274-65082296 CTCAACCTCTCTAATGGTGGAGG + Intronic
1010009950 6:71038016-71038038 CACACTCTCTCCAGAGGCTGTGG - Intergenic
1011459323 6:87587134-87587156 CTCAGTCTCTCCAAGTGCTGGGG + Intronic
1013968606 6:115987048-115987070 CTCAATCTCTTCATAGGCCATGG + Intronic
1018526248 6:164713248-164713270 GTCAGTCTCTCCAAATGTGGGGG - Intergenic
1018830589 6:167439860-167439882 CTCACTCCCTCCAAAGGCTCTGG - Intergenic
1022385687 7:29896883-29896905 CTAAATCTCTCCAAAGGGCAAGG - Intronic
1022931828 7:35125244-35125266 CTCATTCTCTGCAAAGGCTTAGG - Intergenic
1025827108 7:65019435-65019457 CTCAAACTCTCCCAAGTAGGTGG - Intergenic
1026194091 7:68157432-68157454 CTCAAGGTCTCCAAAGGCTAAGG - Intergenic
1026575256 7:71566281-71566303 CACAAACTCTCCCAAAGCGGTGG - Intronic
1028109202 7:86918706-86918728 CTCAATGTCTACAAAGGGTGTGG - Intronic
1029827714 7:103217743-103217765 CTCATTCTCTGCAAAGGCTTAGG - Intergenic
1030540969 7:110830314-110830336 CTCAGGTTCTCCAAAGGCTGTGG + Intronic
1032899459 7:136290479-136290501 CTCACTCTCTCCATTGGAGGAGG - Intergenic
1036568415 8:9958028-9958050 CTCATCCTCTCCAGAGGCCGTGG + Intergenic
1039013783 8:33124093-33124115 CTCAATCTCCCCAGAGGATGGGG + Intergenic
1041468335 8:58180455-58180477 CTCAATCTCTCCTAGGGCCCAGG - Intronic
1042137522 8:65645699-65645721 CCCCATCTCTACAAAGGGGGGGG - Intronic
1043555113 8:81421373-81421395 CTCCATCTCTCCTAAGTCAGAGG - Intergenic
1047934456 8:129763171-129763193 CTCATTCTCTCCAGAGGAGATGG + Intronic
1049806740 8:144544384-144544406 CTCAATCTCTGCAGAGGCAAAGG + Intronic
1052169174 9:25372618-25372640 CTCAATCTCACCAATGGCAACGG - Intergenic
1055553736 9:77454906-77454928 CTGAATCTATTCAAAGGCTGTGG + Intronic
1057956555 9:99413513-99413535 ATCAAACTCTCCAAATGGGGGGG - Intergenic
1059671574 9:116497083-116497105 TTCAATCTCTCATAAGGCTGTGG + Intronic
1060196519 9:121627545-121627567 CTCACTCTCTGCAAAGACTGTGG + Intronic
1062362535 9:136194447-136194469 CTCAGTCTCCCCACAGGCAGAGG + Intergenic
1203612509 Un_KI270749v1:21971-21993 CTCAGTCTCCCCAATGGCTGGGG + Intergenic
1190059329 X:47200878-47200900 CTCCATCTCTCCACAGGTGGTGG + Exonic
1190330673 X:49233357-49233379 CTTAATCCCTCCAAAGCTGGGGG - Exonic
1191650312 X:63529814-63529836 CTTTCTCTTTCCAAAGGCGGAGG - Intergenic
1194368707 X:93043116-93043138 CTCAAGCTATCCAAAGGAGCTGG + Intergenic
1198179874 X:134196024-134196046 CTCAATCCCTCCACAGCCTGTGG - Intergenic
1200676910 Y:6159445-6159467 CTCAAGCTATCCAAAGGAGCTGG + Intergenic