ID: 1163775267

View in Genome Browser
Species Human (GRCh38)
Location 19:19213630-19213652
Sequence CACCCCAGACACAGACCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163775267_1163775273 13 Left 1163775267 19:19213630-19213652 CCCCAGGGTCTGTGTCTGGGGTG 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1163775273 19:19213666-19213688 GTCCCGCTTGTGTATCTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1163775267_1163775271 9 Left 1163775267 19:19213630-19213652 CCCCAGGGTCTGTGTCTGGGGTG 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1163775271 19:19213662-19213684 GTGTGTCCCGCTTGTGTATCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1163775267_1163775278 21 Left 1163775267 19:19213630-19213652 CCCCAGGGTCTGTGTCTGGGGTG 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1163775278 19:19213674-19213696 TGTGTATCTGGAGGGGCCAAGGG 0: 1
1: 0
2: 0
3: 25
4: 241
1163775267_1163775277 20 Left 1163775267 19:19213630-19213652 CCCCAGGGTCTGTGTCTGGGGTG 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1163775277 19:19213673-19213695 TTGTGTATCTGGAGGGGCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 218
1163775267_1163775272 12 Left 1163775267 19:19213630-19213652 CCCCAGGGTCTGTGTCTGGGGTG 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1163775272 19:19213665-19213687 TGTCCCGCTTGTGTATCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 64
1163775267_1163775274 14 Left 1163775267 19:19213630-19213652 CCCCAGGGTCTGTGTCTGGGGTG 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1163775274 19:19213667-19213689 TCCCGCTTGTGTATCTGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163775267 Original CRISPR CACCCCAGACACAGACCCTG GGG (reversed) Intronic
900024767 1:261513-261535 TACTCCAGATACAGACACTGTGG - Intergenic
900028375 1:350918-350940 TACTCCAGATACAGACACTGTGG - Intergenic
900206336 1:1433442-1433464 CAGCCCAGGCCCAGACCGTGGGG + Intergenic
900659606 1:3776005-3776027 CCCCACAGACACGGACCCTGCGG + Intergenic
901615362 1:10535216-10535238 CACCCCAGACACCAGCCCTATGG - Intronic
901626161 1:10626358-10626380 ACCCCCAGACACAGCCCCTCAGG - Intronic
901938521 1:12644594-12644616 CAGCCCAGACAAAGACCCCCAGG - Exonic
902237187 1:15064993-15065015 CACACCAGACACCGTCCTTGGGG + Intronic
903378121 1:22879207-22879229 CACCACACACACAGACCCAGTGG + Intronic
903423968 1:23239272-23239294 CATCCCAGAAACAAATCCTGTGG - Intergenic
903655139 1:24944313-24944335 CAGCACAGACAAAGGCCCTGTGG - Intronic
903772683 1:25773947-25773969 CACCCCTGACTCAGAACCTCTGG + Intronic
904442737 1:30542202-30542224 CAGCCCAGCCTCAGAGCCTGGGG - Intergenic
906200077 1:43954298-43954320 CAGCCCAGAGACAGCCCCAGGGG - Intronic
906722315 1:48017895-48017917 CATCCCAGCCACAGAGCCTCTGG - Intergenic
909453362 1:75823393-75823415 TTCTCCAGAAACAGACCCTGAGG - Intronic
909567437 1:77068992-77069014 CACTCCAGAGACAGACCCTTTGG - Intergenic
910152465 1:84167467-84167489 TACCTCCGACACTGACCCTGTGG + Intronic
910426877 1:87127468-87127490 CAACCCAAACACAGACCCCCAGG - Intronic
912543508 1:110434398-110434420 GACCCCCGACACCCACCCTGTGG - Intergenic
915902520 1:159856685-159856707 CACCCCAACCTCAGTCCCTGTGG + Intronic
915945875 1:160151575-160151597 CCCCCCAGTCCCAGGCCCTGTGG - Exonic
918181293 1:182087616-182087638 CACCCCAGCTGCAGCCCCTGAGG + Intergenic
918309053 1:183272554-183272576 CACCCCAAACACATCCCTTGTGG - Intronic
919464471 1:197912797-197912819 CGCCCCGGACACTGATCCTGAGG - Intronic
919886179 1:201936555-201936577 CATCAAAGACACAGGCCCTGGGG - Intronic
922606795 1:226894555-226894577 TGCCCCAGATTCAGACCCTGTGG - Intronic
922764268 1:228149378-228149400 CACACCACACACAGCCCCTGGGG - Intergenic
922804079 1:228376853-228376875 CATTCCAGACACAGATCCAGAGG + Exonic
1062840458 10:666466-666488 CACCCAAGACTGAGATCCTGTGG + Intronic
1063463630 10:6229610-6229632 CATCACAGACACTGGCCCTGAGG - Intronic
1067087966 10:43252856-43252878 CACCCTCGACACAGACCCACTGG + Intronic
1067089753 10:43260557-43260579 CTCCCCAGACCCAGACCCCACGG + Intronic
1067107002 10:43373197-43373219 CACCCCAGGCCCAGACCTTTGGG + Intronic
1067373782 10:45709027-45709049 CACACCCTGCACAGACCCTGAGG - Intergenic
1067379901 10:45763205-45763227 CACACCCTGCACAGACCCTGAGG + Intronic
1067686112 10:48466767-48466789 CGCCCCAGGCCCGGACCCTGAGG + Intronic
1067881612 10:50050794-50050816 CACACCCTGCACAGACCCTGAGG - Intergenic
1067887600 10:50103859-50103881 CACACCCTGCACAGACCCTGAGG + Intronic
1068775542 10:60864209-60864231 TTCCCCAGAAACAGAGCCTGAGG - Intergenic
1069893668 10:71667293-71667315 CAGCCCAGTCTCAGCCCCTGTGG - Intronic
1071124816 10:82321272-82321294 CACCCCTGTCACACATCCTGTGG + Intronic
1071294333 10:84208322-84208344 CACCCCAGGGAGAGATCCTGCGG + Exonic
1071503394 10:86219034-86219056 TACCCCAGAGACAGACCCACAGG - Intronic
1071824383 10:89310257-89310279 GAGCTCAGACACAGTCCCTGGGG + Intronic
1073390849 10:103175500-103175522 CAACCCAGACTCACACCTTGGGG - Intronic
1074321024 10:112402474-112402496 CACCCAAGACACACACCCTGGGG + Intronic
1074456916 10:113603377-113603399 CAGCACAGGCATAGACCCTGAGG - Intronic
1074535567 10:114326107-114326129 GCCCCCAGGGACAGACCCTGTGG - Intronic
1074983259 10:118636366-118636388 CTCCCCAGACACTGAATCTGCGG - Intergenic
1075081891 10:119389835-119389857 CACCCAACACACAGATCATGGGG + Intronic
1075342049 10:121654854-121654876 CACCCCAAACACTGCCCCTGTGG - Intergenic
1076316373 10:129544680-129544702 CAGCGCAGACACAGGGCCTGGGG - Intronic
1076484265 10:130805772-130805794 GACCCGGGACACAGACCCAGAGG + Intergenic
1076717656 10:132374576-132374598 CCCCACAGACACAGAAGCTGTGG - Intronic
1076907415 10:133370120-133370142 CACACCAGACACAGGCAGTGGGG + Intronic
1077119228 11:899220-899242 CACCCCAGGCACAGGGACTGTGG + Intronic
1077433388 11:2526880-2526902 AAAGCCACACACAGACCCTGGGG - Intronic
1078444375 11:11393154-11393176 CACCCCACACCCAGACCCCATGG - Intronic
1078563051 11:12389834-12389856 CTCCCCAGAAACACTCCCTGAGG - Intronic
1080698641 11:34624998-34625020 CACCACAGCCACAGAATCTGAGG - Intronic
1082000202 11:47389950-47389972 CACCCCAGACCCTTCCCCTGTGG + Intergenic
1083640198 11:64141290-64141312 CTCTCCAGACCCTGACCCTGGGG - Intronic
1084426099 11:69085307-69085329 CACCCCTGAGACACTCCCTGTGG - Intronic
1084508661 11:69587609-69587631 CTTCCCAGACACACACCCTTGGG + Intergenic
1084656955 11:70525336-70525358 CACCCAAGGAACAGACTCTGTGG + Intronic
1085507412 11:77068188-77068210 CACCCCACCCCCAGACCCTGGGG - Intronic
1085726898 11:78962209-78962231 AACCCCGGACTCAGACTCTGAGG - Intronic
1087774479 11:102244931-102244953 GACACCTGACCCAGACCCTGAGG + Intergenic
1088000761 11:104877357-104877379 CCCCCCACACACACACACTGAGG - Intergenic
1088746432 11:112808395-112808417 ACCCCCAGAGACAGAACCTGGGG - Intergenic
1089272908 11:117314516-117314538 CTTCCCAGACACAGATCCGGAGG + Intronic
1090247219 11:125224964-125224986 CACCCAGCACCCAGACCCTGGGG - Intronic
1090423313 11:126590497-126590519 CACGGCAGACACAGCCCTTGAGG - Intronic
1090711158 11:129386942-129386964 CACCCTGGCCACAGATCCTGTGG - Intronic
1091536074 12:1410985-1411007 CACCTCGGACACATCCCCTGGGG + Intronic
1092057666 12:5521285-5521307 AAGCCCAGACATAGAGCCTGGGG - Intronic
1096078561 12:48819146-48819168 CGACCCAGACTCAGACCCTGGGG + Intronic
1096583262 12:52601826-52601848 CTCCCCAGACACACACCCAGAGG - Intergenic
1098112047 12:67133264-67133286 TACCCCAGATCCAGACCTTGTGG - Intergenic
1099460120 12:82911198-82911220 CCCCCCACACCCAAACCCTGGGG - Intronic
1101509077 12:105376483-105376505 CTCCCCAGACACAGACCTTTTGG + Intronic
1102034894 12:109765497-109765519 CAGCCCAGGCAAAGGCCCTGAGG - Intronic
1102932875 12:116876186-116876208 GACTCCAGACAGAGACCATGTGG + Intronic
1103623307 12:122201503-122201525 CACCACCCACACAGGCCCTGTGG - Intronic
1103702898 12:122856842-122856864 CAGCCCTGACCCAGACCCAGGGG + Intronic
1104348912 12:128027850-128027872 CAGCCCAGACACAGGCACTGAGG + Intergenic
1104750679 12:131236179-131236201 CTCTCCAGGCACAGACCTTGTGG - Intergenic
1105336345 13:19473483-19473505 CACCTCAAACACAGGCCATGGGG + Intronic
1105668639 13:22588230-22588252 CACCCCAGAAACAGCTACTGAGG - Intergenic
1105881136 13:24607351-24607373 CGCCCCACACACACACCCTGGGG - Intergenic
1106100133 13:26687427-26687449 CACTCGAGACACACACACTGAGG - Exonic
1108236059 13:48406695-48406717 CACCACAGGCAAAGGCCCTGTGG - Intronic
1112062960 13:95760033-95760055 CATCCCAAACACAAACCTTGAGG - Exonic
1113332288 13:109341533-109341555 CACCTTGGACACAGACCCTCTGG + Intergenic
1113603182 13:111585763-111585785 TCCCCCACACACAGCCCCTGAGG - Intergenic
1114665287 14:24374026-24374048 CACCCCAGAGACAGAGTCTGTGG - Intronic
1116153919 14:41178544-41178566 CAGCCCAGACACAGGTTCTGTGG - Intergenic
1117403765 14:55381779-55381801 CACCCCAGACAGAAACCCCATGG - Intronic
1117565143 14:56986800-56986822 CACCACAGACACAGCACCTGTGG - Intergenic
1121466072 14:94116272-94116294 CTCCCCAAACAAAGACCCCGAGG + Intronic
1121890228 14:97583384-97583406 GACCCCACACACTGGCCCTGGGG + Intergenic
1122117841 14:99536512-99536534 CTCCCCGGACCCCGACCCTGGGG - Intronic
1122789530 14:104178485-104178507 CAGCCCAAGCACAGCCCCTGCGG - Intronic
1122883913 14:104702174-104702196 CAGCCCAGACAGAGCCCTTGAGG + Intronic
1125893215 15:43281320-43281342 CACCCCATCCACAGGCCCAGGGG + Intronic
1127455798 15:59155042-59155064 CTCCCCATCCCCAGACCCTGTGG - Intronic
1128225699 15:65999916-65999938 TTCCCCAGAAGCAGACCCTGAGG + Intronic
1130394840 15:83492918-83492940 TCCCCCAGAAACAGACCCTGGGG - Intronic
1131363468 15:91816676-91816698 CACCTGTGAAACAGACCCTGGGG + Intergenic
1132051483 15:98611201-98611223 CACCCCAGACGCCTACCCAGGGG + Intergenic
1132114343 15:99124800-99124822 CACCCCCAACACAGGGCCTGTGG - Intronic
1132292738 15:100714596-100714618 CTCCCCAGCCTCTGACCCTGGGG - Intergenic
1132295329 15:100730271-100730293 CACCCAGGACACAGAGGCTGGGG - Intergenic
1132604014 16:786099-786121 CACCCCCGACCCTGACCCCGAGG - Exonic
1132927222 16:2437123-2437145 CTCATCAGACACAGACACTGCGG - Exonic
1133040533 16:3058104-3058126 CCACCCAGCCACACACCCTGGGG + Intronic
1133046908 16:3093082-3093104 CACCCAATACGCAGACCCAGAGG + Intronic
1133125406 16:3642895-3642917 CACACCAGACGCAGAGCCTGCGG - Intronic
1133243065 16:4427497-4427519 CACCCCGCTCACAGACGCTGGGG - Intronic
1133477047 16:6133778-6133800 CAGCACAGGCAAAGACCCTGTGG - Intronic
1136186314 16:28590824-28590846 CAACCCGGAGACGGACCCTGAGG + Exonic
1136188682 16:28602537-28602559 CAACCCCGAGACAGACCCCGAGG + Intergenic
1136191152 16:28615531-28615553 CAACCCCGAGACAGACCCCGAGG + Intronic
1136994240 16:35177176-35177198 CAGCCTAGCCACAGACCCTGAGG - Intergenic
1138640208 16:58379790-58379812 CTCACCAGAAACAAACCCTGTGG + Intronic
1140092648 16:71850727-71850749 GACCCCGGACACTGACCTTGAGG + Exonic
1140532977 16:75683036-75683058 CAGCCCTGTCACAGAGCCTGCGG + Intronic
1141188961 16:81809561-81809583 TCCCCCAGAAACAGACTCTGAGG - Intronic
1141683716 16:85558261-85558283 TTCCCCAGCCACAGACCCGGGGG - Intergenic
1141825059 16:86472939-86472961 CAGCCAAGACACAGACCCCTCGG - Intergenic
1141944298 16:87298893-87298915 CACCCCAAAAGCAGAGCCTGAGG + Intronic
1142226473 16:88880175-88880197 CACCACTGAAAGAGACCCTGAGG + Intronic
1142456385 16:90227865-90227887 TACTCCAGATACAGACACTGTGG + Intergenic
1143189928 17:5033678-5033700 CATCCCTGGCCCAGACCCTGAGG - Exonic
1143766003 17:9138173-9138195 CACCCCAGACACCCGCCCAGGGG - Intronic
1144425861 17:15141691-15141713 CTCCCCAGACTCAGAGCCTGGGG + Intergenic
1144725546 17:17500194-17500216 CACTGCACACACTGACCCTGCGG - Intergenic
1147310657 17:39594270-39594292 TACCACAGACAAAGACACTGAGG - Intergenic
1147596656 17:41722342-41722364 CACCCCAGAGACTGACTCAGTGG - Intronic
1148107065 17:45124412-45124434 CCCCCCAAACACACACCCAGTGG + Intronic
1148806703 17:50267446-50267468 CCCCCCAGAGAGAGGCCCTGTGG - Intergenic
1149607730 17:57936548-57936570 CATCCCAGCCACTGTCCCTGAGG - Intronic
1151340767 17:73469381-73469403 CTGCCCAGGCACAGACCCTGGGG - Intronic
1152130372 17:78472615-78472637 CACCCCACACACAGCCCCCGGGG - Intronic
1152633734 17:81421973-81421995 CACCCGAGACCCCGGCCCTGAGG - Intronic
1155248728 18:23935887-23935909 CACTCCAGACCCAGTTCCTGGGG - Intronic
1157572328 18:48721307-48721329 CATCCTAGACGCAGACCTTGGGG - Intronic
1159879698 18:73846593-73846615 CTCCCCAGACACAGAACAAGAGG + Intergenic
1160057038 18:75492706-75492728 CACACCAAACACAGACCTTGAGG - Intergenic
1160501219 18:79401878-79401900 CACCCCAGTCAGAGGCCCAGGGG + Intronic
1160657411 19:280661-280683 CCACCCAGACTCAGGCCCTGGGG + Intergenic
1160824859 19:1074791-1074813 CGCCCCAGCCCCTGACCCTGCGG + Exonic
1160940536 19:1618589-1618611 CAGCCCAGGCAAAGGCCCTGGGG - Intronic
1160951002 19:1667427-1667449 CATCCTGGGCACAGACCCTGAGG - Intergenic
1161154649 19:2726412-2726434 CACCCCAGAGACTGCTCCTGAGG + Intronic
1163117866 19:15199402-15199424 CAACCCATACACAGACACAGCGG - Intronic
1163775267 19:19213630-19213652 CACCCCAGACACAGACCCTGGGG - Intronic
1164738255 19:30558374-30558396 CACCCCAGCCACAGTTCCTCTGG - Intronic
1164945813 19:32292180-32292202 CAGCCCAGAAAGCGACCCTGCGG - Intergenic
1165071566 19:33258571-33258593 CAGCCCAGACACAGATCCACAGG - Intergenic
1165105666 19:33468488-33468510 CAGCCCAGACAGAGGCCCCGAGG + Intronic
1165141826 19:33704339-33704361 CAATGCAGACCCAGACCCTGAGG - Intronic
1165333444 19:35154116-35154138 CACCCCAGACCCAGGGCCTCAGG + Exonic
1165657134 19:37543989-37544011 CACTCCAGACACATTCCCTTAGG - Intronic
1165728317 19:38127951-38127973 CTCACCAGATACAGAACCTGCGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167038453 19:47008194-47008216 CAAGCCAGAGAGAGACCCTGGGG + Intergenic
1167044272 19:47040722-47040744 CCCCCCACACACACATCCTGAGG - Intronic
1168063534 19:53907235-53907257 CCCCCCAGACCCCGCCCCTGGGG + Exonic
1168105753 19:54164844-54164866 CACCCCAGGCCCCGCCCCTGAGG + Intronic
1168114883 19:54216968-54216990 GACCCCTAACACAGACCATGAGG - Exonic
1168288242 19:55345029-55345051 GACACCACACACAGACGCTGGGG + Intronic
925697420 2:6595612-6595634 CACCCCAGAGCACGACCCTGTGG - Intergenic
925972220 2:9113620-9113642 CACCCAACACCCAGACCCCGAGG + Intergenic
926155941 2:10454122-10454144 GACCCCAGCCACAGGCCCTTCGG - Intergenic
927925139 2:27006967-27006989 CAGCCCAGACACAGCACCAGAGG - Intronic
931588521 2:63855486-63855508 CACCCCAGACCCAAACACTTTGG - Intronic
932329828 2:70891936-70891958 CGGCCCTGGCACAGACCCTGGGG - Intergenic
933480866 2:82855366-82855388 CCTGCCAGAAACAGACCCTGAGG - Intergenic
935848944 2:107198070-107198092 CACTCAACACACACACCCTGAGG - Intergenic
936255691 2:110908836-110908858 AGCACCAAACACAGACCCTGCGG + Exonic
936379695 2:111973429-111973451 CACCTCTGACTCAGACCCCGTGG - Intronic
937288085 2:120765580-120765602 CACCCCTGAACCAGATCCTGAGG - Intronic
938250694 2:129813370-129813392 CACAGCAGACACAGAGCATGGGG + Intergenic
938320647 2:130360000-130360022 TAGCCAAGGCACAGACCCTGAGG - Intronic
938709942 2:133967567-133967589 CACCCCAGCCAGAGACAATGGGG + Intergenic
938969720 2:136421059-136421081 CACCCCACCCTCATACCCTGTGG - Intergenic
939995491 2:148915695-148915717 TCCCCCAGAAGCAGACCCTGAGG + Intronic
944844468 2:203655082-203655104 CATCACAGGCAAAGACCCTGAGG + Intergenic
945198157 2:207256705-207256727 CATGCCAGACACAGCCCCTATGG + Intergenic
946245136 2:218383084-218383106 CATCCCAGACACAAAACCGGTGG + Exonic
946507443 2:220317116-220317138 CACCCCAAACACTGAGCCTCAGG + Intergenic
947175940 2:227367641-227367663 AACACAACACACAGACCCTGTGG - Intronic
947715203 2:232335765-232335787 CACTCCAGGCACTGGCCCTGCGG + Exonic
947729979 2:232422351-232422373 CAGACCAGGCACAGACCGTGAGG + Intergenic
948505324 2:238424023-238424045 CACCCCAAACACAGGCCCACAGG + Intergenic
948691128 2:239705910-239705932 CCCCTGAGACACAGACCCTCTGG + Intergenic
948785960 2:240353115-240353137 CACCCCAGACCCAGAGCTGGAGG - Intergenic
948807911 2:240460879-240460901 CACTGCAGACAAAGACCCAGGGG - Intronic
949087878 2:242172659-242172681 TACTCCAGATACAGACACTGTGG + Intergenic
1168842126 20:916253-916275 CATCCCAGGCACAGCCCCTAGGG - Exonic
1169674236 20:8135610-8135632 CCACCCATCCACAGACCCTGGGG - Intronic
1169830916 20:9823800-9823822 CCCCCCAGAAACAGACCTTGAGG - Intronic
1170814189 20:19698748-19698770 TCCCCGAGACAAAGACCCTGTGG - Intronic
1171085392 20:22233737-22233759 TGCCCCAGACACACAACCTGAGG - Intergenic
1171471479 20:25375473-25375495 CAACACAGAGAGAGACCCTGGGG - Intronic
1172225532 20:33302844-33302866 CAGGCCACACACAGAGCCTGTGG + Intronic
1173125099 20:40329351-40329373 TACCCCAGAGACTGACCTTGTGG + Intergenic
1173596063 20:44258969-44258991 CCCCCCATACACAGACTATGGGG + Intronic
1174266446 20:49335613-49335635 CACTCCTCACACAGACCGTGTGG - Intergenic
1175501109 20:59451734-59451756 CACCACAGACGTGGACCCTGGGG + Intergenic
1175527076 20:59642421-59642443 CACCCCAGAGATAACCCCTGTGG + Intronic
1175922678 20:62457441-62457463 CTCCCCACACACAGGCCCCGGGG + Intergenic
1175928016 20:62480423-62480445 CGCCTCAGACACGGCCCCTGTGG + Intergenic
1175988539 20:62776387-62776409 ACCCCCAGATGCAGACCCTGAGG - Intergenic
1176058299 20:63160540-63160562 CAGCCCAGCCACATAGCCTGAGG - Intergenic
1179518931 21:41929462-41929484 CACAACAGACACAGACCCTGTGG + Intronic
1180071260 21:45436843-45436865 CTCCCCAGTCACAGACCCCCAGG - Intronic
1180953168 22:19729915-19729937 CCCTCCACACACTGACCCTGGGG + Intergenic
1182227686 22:28812198-28812220 CTTCTCAGACACACACCCTGGGG + Intergenic
1183230797 22:36580630-36580652 CACTCCATACTCAGAGCCTGGGG - Intronic
1183523676 22:38311063-38311085 CTCCCCAGACTCAGACCCAGAGG + Intronic
1183531918 22:38360989-38361011 CACCTCAAACACAGGCCATGGGG + Intronic
1183723862 22:39577805-39577827 CAACCAAGCCACCGACCCTGGGG - Intronic
1184152101 22:42645207-42645229 GACGACAGACACAGATCCTGCGG - Intronic
1184428054 22:44424655-44424677 CCTCCCAGACAAAGGCCCTGGGG - Intergenic
1184443044 22:44530442-44530464 CAGCCCTGCCACAGTCCCTGTGG + Intergenic
1184655511 22:45939995-45940017 CACCCCAGAAAGAAACCCTGTGG - Intronic
949339525 3:3013850-3013872 CAGCCCAGAGACACACCCTAGGG + Intronic
950210544 3:11119764-11119786 TACCCCAGAAGCAGTCCCTGAGG - Intergenic
950265522 3:11570182-11570204 CACCACAGACACCGGCCCTGTGG + Intronic
950419112 3:12886463-12886485 CACCCCATACACAGTGACTGAGG + Intergenic
951855048 3:27186851-27186873 CACACCACACACAGCCCATGGGG - Intronic
953668267 3:44941576-44941598 CACCCCAGACACCCACACTGAGG - Intronic
953787426 3:45921620-45921642 CTCCCCAGACACCGCCTCTGAGG + Exonic
954134768 3:48576833-48576855 GACCCCTGACCCTGACCCTGGGG - Intronic
954136600 3:48584838-48584860 CACCCCAGGCTCCCACCCTGTGG + Intronic
954444384 3:50539105-50539127 CAGGCCAGACACAAACCCTTTGG + Intergenic
954448928 3:50561360-50561382 CACCTGAGACTCAGACGCTGTGG - Intronic
954501930 3:51025604-51025626 CACCCCATGAACAGAACCTGGGG - Intronic
957212113 3:77272529-77272551 CACCTCAAACACAAACACTGGGG + Intronic
957765491 3:84619557-84619579 CACTCCAGACTCAGGCTCTGTGG + Intergenic
959585522 3:108021910-108021932 TACATCAGACACAGAACCTGAGG - Intergenic
959878983 3:111420871-111420893 CATCTCAGGGACAGACCCTGAGG + Intronic
961189215 3:124943551-124943573 GGCCCCAGACACAGAGCCTTTGG + Intronic
961451393 3:127003881-127003903 CAGGCCAGCCACAGGCCCTGTGG - Intronic
961718079 3:128872537-128872559 CACCCCAGACACTTCCCCTGTGG - Intergenic
962877134 3:139543653-139543675 GAGCCCTGAAACAGACCCTGAGG + Intergenic
963951278 3:151204912-151204934 CAATCCAGACACAGAAACTGTGG - Intronic
966288740 3:178329501-178329523 CTCACCAGATACAGACTCTGTGG - Intergenic
966857398 3:184204425-184204447 CACCCCAACCACGGACACTGGGG + Intronic
968620962 4:1603329-1603351 CAGGCCAGCCACAGTCCCTGAGG + Intergenic
972479179 4:39481545-39481567 ACCCCCAGGCACAGACCCAGGGG - Intergenic
973869182 4:55147555-55147577 GACCCCACACACACACCCAGAGG + Intergenic
974368580 4:60985340-60985362 CACCCTTGTCACACACCCTGAGG - Intergenic
976555898 4:86451510-86451532 TTCCCCAGAACCAGACCCTGAGG + Intronic
980134632 4:128847560-128847582 CATCTCAGACACAGGCTCTGAGG - Intronic
980480464 4:133380347-133380369 CACCCCTGTCACACACCCTGAGG + Intergenic
981010518 4:139920792-139920814 CACCCCAGACAGTCATCCTGCGG - Intronic
982726672 4:158913693-158913715 GACTACAGGCACAGACCCTGTGG - Intronic
983316425 4:166137970-166137992 AACAACAGACACAGACACTGAGG + Intergenic
984117833 4:175704360-175704382 CACCCCACACACACACAATGTGG + Intronic
984942210 4:184942988-184943010 CTCACCAGAAGCAGACCCTGGGG - Intergenic
985137310 4:186800209-186800231 AACTCCAGACACTGACCCTAAGG - Intergenic
985519074 5:362641-362663 CACTCCTGTCTCAGACCCTGAGG + Intronic
985721167 5:1489971-1489993 CACCCATGGCACAGCCCCTGGGG - Intronic
985868281 5:2533435-2533457 CCCCCCAGACACAGATTCTGAGG + Intergenic
985996826 5:3601556-3601578 TCCCCCAGCCACAGACCCTTGGG - Intergenic
986013810 5:3740461-3740483 CACACCGGACTCAGACCCTCCGG - Intergenic
986850885 5:11812450-11812472 CTCCCCAGTAACAGACACTGTGG + Intronic
991556165 5:67897033-67897055 CCCCCCTGAAGCAGACCCTGAGG + Intergenic
992113250 5:73515757-73515779 AACTCCAGACTCAGCCCCTGAGG - Intergenic
994559331 5:101347175-101347197 CACCCCAATCTGAGACCCTGGGG - Intergenic
995863589 5:116666486-116666508 CACCCTATACACACAACCTGAGG + Intergenic
995888940 5:116928125-116928147 ATCCACAGACACAGAACCTGTGG - Intergenic
997388349 5:133493186-133493208 AACCCCAGACTCACACACTGGGG - Intronic
997592679 5:135085606-135085628 CTCCCCAGCCAGAGACCCTGGGG - Intronic
997638907 5:135435690-135435712 CACTGCAGACACAGAGGCTGGGG - Intergenic
998039765 5:138944765-138944787 CAGCCCAAGCCCAGACCCTGGGG + Intergenic
999112984 5:149138113-149138135 CAGCCCAGCAACAGCCCCTGAGG + Intergenic
999657832 5:153828008-153828030 CACCTCAGTCCCAGACACTGTGG - Intergenic
1000006923 5:157194331-157194353 CACCCCAGGAACAGATCCTCAGG - Intronic
1000398885 5:160804353-160804375 CACCCCAGAAGTAGACACTGAGG - Intronic
1000480346 5:161766230-161766252 CAGCCCAGGCAGAGATCCTGGGG + Intergenic
1002520987 5:179793244-179793266 CTCCCCACACTCAGGCCCTGTGG - Intronic
1002745615 5:181469453-181469475 TACTCCAGATACAGACACTGTGG + Intergenic
1002792040 6:443989-444011 CGCCCCAGAGAGTGACCCTGTGG - Intergenic
1003094507 6:3131838-3131860 CACCCCTGACACAGCTCCTTGGG + Intronic
1003870494 6:10398833-10398855 GACCCCAGAGACAGACAGTGTGG + Intronic
1004035198 6:11916931-11916953 TCCCCCAGAAGCAGACCCTGAGG + Intergenic
1004046595 6:12031159-12031181 CAGCCCACACACAGACCCACAGG - Intronic
1005468772 6:26141492-26141514 CAACCCAGAGAAAGTCCCTGGGG - Intergenic
1005499353 6:26416531-26416553 CATCCCAGACCCAGTCCATGTGG - Intergenic
1005504140 6:26455356-26455378 CATCCCAGACCCAGTCCATGTGG - Intergenic
1005917655 6:30367529-30367551 CACCCCAAACACAGTCCCTAAGG - Intergenic
1005980065 6:30829827-30829849 CGCCCCAGACACACACCCACAGG - Intergenic
1007088268 6:39166048-39166070 GACCCCAGAGACAGGCCCTCAGG - Intergenic
1011629110 6:89307682-89307704 CACAACAGTCACAGGCCCTGAGG - Intronic
1012180973 6:96152261-96152283 CAGCCCAGACATAATCCCTGAGG + Intronic
1013929120 6:115508982-115509004 CACCCCACACACACACACAGAGG + Intergenic
1015774315 6:136798315-136798337 CTCCCAAGACAGAGACTCTGGGG - Intergenic
1016872738 6:148835078-148835100 ATCCACAGACACAGAACCTGAGG - Intronic
1017443783 6:154489179-154489201 CATCTCAGACACAGGCCCAGGGG - Intronic
1018828383 6:167423976-167423998 CCCCCCACACACACACCCGGCGG + Intergenic
1018828411 6:167424057-167424079 CCCCCCACACACACACCCGGCGG + Intergenic
1019250532 6:170743008-170743030 TACTCCAGATACAGACACTGTGG + Intergenic
1019354057 7:569851-569873 CACCCCAGGGCCAGACCCCGAGG + Intronic
1019609462 7:1929635-1929657 CACACCAGAGACAGCCCTTGGGG + Intronic
1021403005 7:20231501-20231523 CTCCCCAGTAACAGACCCTAAGG + Intergenic
1021525376 7:21580592-21580614 CTCCCCAGACACTGAACCTGCGG - Intronic
1022424252 7:30253124-30253146 CACCCCAGACCTAGGCCCTCTGG + Intergenic
1022530608 7:31064740-31064762 CCCCCAAGACACTGCCCCTGGGG + Intronic
1024055500 7:45657701-45657723 CAACACAGACACAGAGCGTGGGG - Intronic
1024197006 7:47069087-47069109 CTCACCAGAAACCGACCCTGCGG + Intergenic
1025107240 7:56181851-56181873 CATCCCAGCCTCAGCCCCTGTGG - Intergenic
1025320368 7:58088020-58088042 CAGCCCAGGAACAGAGCCTGGGG - Intergenic
1025478676 7:60957008-60957030 CAGCCCAGGAACAGAGCCTGGGG - Intergenic
1026856516 7:73758749-73758771 CAGGCCAGCCACAGACCTTGAGG + Intergenic
1027343229 7:77232224-77232246 CAAGCCACACACAGACCCAGTGG - Intronic
1027516414 7:79147700-79147722 CTCTCCAGAAACAGACTCTGTGG + Intronic
1028233581 7:88333303-88333325 CCCCCAAGAAACAGATCCTGAGG - Intergenic
1028257689 7:88620828-88620850 CACCCCAGACTCAGAAACTGTGG + Intergenic
1032366511 7:131305070-131305092 CTCACCAGACACTGAACCTGCGG + Intronic
1033234773 7:139629599-139629621 CAGCCCAGCCACAAACTCTGGGG - Intronic
1033652090 7:143351353-143351375 CTGCCCAGACTCAGACCCTTGGG - Intronic
1034182244 7:149147797-149147819 CCCCCGAGACCCAGACCCCGAGG + Intronic
1034405052 7:150897406-150897428 CACCAGAGACAGAGACCCTGGGG + Intergenic
1034446676 7:151117239-151117261 GACCCCCCACCCAGACCCTGTGG - Intronic
1035084021 7:156240777-156240799 CACCCCACACACACAGGCTGTGG + Intergenic
1035291624 7:157842954-157842976 CACCGCAGACACAGATCCATTGG + Intronic
1035406618 7:158602810-158602832 CACCCAACACACAGAGCCTGGGG + Intergenic
1035671753 8:1423361-1423383 CCTCCCAGAGACAGAACCTGGGG - Intergenic
1035675201 8:1451288-1451310 CTCCCCAGACTCAGTCCCTGGGG + Intergenic
1037674551 8:21042530-21042552 CCCCCCAGACTCAGACCCTGGGG + Intergenic
1037880080 8:22569007-22569029 AACACCAGACACAAGCCCTGGGG - Intronic
1037880787 8:22572481-22572503 CACCCCACCCACATCCCCTGGGG - Intronic
1038688875 8:29743072-29743094 GACCCCAGCCACAAGCCCTGGGG - Intergenic
1041279862 8:56198637-56198659 CGCTCCAGACAGAGGCCCTGAGG - Intronic
1041770549 8:61467925-61467947 CACTGCACACACATACCCTGTGG - Intronic
1043526982 8:81107793-81107815 CCCCGCAGAGACAGCCCCTGAGG - Intronic
1044609820 8:94080473-94080495 CACCTCTGTGACAGACCCTGTGG + Intergenic
1044853375 8:96451043-96451065 CACCACACACACACACCTTGGGG - Intergenic
1046257417 8:111719618-111719640 TACCCCAGAAATAGACACTGAGG - Intergenic
1048909318 8:139119489-139119511 CATCTCAGACACAGGCACTGGGG - Intergenic
1049001189 8:139826462-139826484 CCCCCCAGGCACCGACCCTGCGG - Intronic
1049238750 8:141525886-141525908 CACCCCAGCCCCAGACCTGGTGG + Intergenic
1049449946 8:142655179-142655201 CTGCCCACACAGAGACCCTGGGG + Intergenic
1049833029 8:144714123-144714145 GTCCCCAGAAGCAGACCCTGAGG + Intergenic
1053163421 9:35829058-35829080 CACCCCAAGCACAGAGCCCGAGG - Intronic
1055195194 9:73582332-73582354 CACCTCAGGCACAGAACCTAAGG - Intergenic
1055430948 9:76243109-76243131 CACAGCAGACACTGACCCTCTGG + Intronic
1057075390 9:92135737-92135759 CACCGCAGGGACAGCCCCTGAGG - Intergenic
1057132819 9:92666525-92666547 AGCTCCAGACACTGACCCTGTGG - Intronic
1057370026 9:94462937-94462959 CATCCCAGACACAGAGGCAGAGG + Intergenic
1059431740 9:114254557-114254579 CAGCCCAGGCACAGATCCGGAGG + Intronic
1060157673 9:121331381-121331403 CAACCCAGACAAAGACCTGGAGG - Exonic
1060191013 9:121592768-121592790 CACTCCAGACACATCCCTTGGGG + Intronic
1060281738 9:122219747-122219769 AACCCCAGCCTCATACCCTGTGG - Intronic
1060594496 9:124840168-124840190 CCCCCCAGACCCCCACCCTGTGG - Intergenic
1060792421 9:126495550-126495572 CACACAAGACACAGTCACTGTGG + Intronic
1060811147 9:126612244-126612266 CACCCCAGACACAGGCACGAAGG + Intergenic
1060872741 9:127055875-127055897 CACCCAAGACAGAGACCCAAAGG - Intronic
1061014744 9:127975171-127975193 CACGCCAGGCCCAGTCCCTGGGG - Intronic
1061207517 9:129173475-129173497 CACCCCACTCACAATCCCTGGGG - Intergenic
1061544110 9:131293910-131293932 CAGCCCAGAGACTGCCCCTGGGG - Intronic
1062236197 9:135509037-135509059 CACCCCGCACACAGACCCACTGG + Intergenic
1062267552 9:135694270-135694292 GGGCTCAGACACAGACCCTGGGG + Intronic
1062597883 9:137307237-137307259 AGCCCCAGACGCAGCCCCTGAGG - Exonic
1203580087 Un_KI270745v1:35607-35629 TACTCCAGATACAGACACTGTGG + Intergenic
1185745935 X:2573488-2573510 TTCCCCAGACACAGAGACTGAGG + Intergenic
1185766476 X:2729741-2729763 CACCCAAGACCAAGACCCAGGGG - Intronic
1186509603 X:10120927-10120949 CACCCCGGACACCTGCCCTGGGG - Intronic
1187275573 X:17814024-17814046 TCCCCCACAAACAGACCCTGAGG + Intronic
1187843883 X:23515988-23516010 TTCCCTAGAAACAGACCCTGAGG - Intergenic
1189331039 X:40145369-40145391 CTCACCCGACACACACCCTGTGG + Intronic
1189516334 X:41716696-41716718 CACCCCACAATCAGACCCTTAGG - Intronic
1190574408 X:51818476-51818498 CACCCCTCTCCCAGACCCTGTGG + Intronic
1190922726 X:54871285-54871307 CACTCCAGACACAATCTCTGTGG - Intergenic
1192055268 X:67767479-67767501 CACCCCATATACACACCCTCTGG + Intergenic
1192185709 X:68945562-68945584 CACACCAGCCATAGCCCCTGTGG + Intergenic
1195302530 X:103544672-103544694 CACTCCAGACCCAGGCTCTGTGG + Intergenic
1195354021 X:104021387-104021409 CACCCACGTCCCAGACCCTGGGG - Intergenic
1200631632 Y:5594478-5594500 CACCCCACACACACACACCGAGG + Intronic