ID: 1163781419

View in Genome Browser
Species Human (GRCh38)
Location 19:19251070-19251092
Sequence GTCTCTCCACACCAGGGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163781412_1163781419 0 Left 1163781412 19:19251047-19251069 CCCAAATGTGCAACCTGTAAAAG 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227
1163781409_1163781419 5 Left 1163781409 19:19251042-19251064 CCTCCCCCAAATGTGCAACCTGT 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227
1163781411_1163781419 1 Left 1163781411 19:19251046-19251068 CCCCAAATGTGCAACCTGTAAAA 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227
1163781408_1163781419 9 Left 1163781408 19:19251038-19251060 CCTTCCTCCCCCAAATGTGCAAC 0: 1
1: 0
2: 0
3: 18
4: 232
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227
1163781407_1163781419 14 Left 1163781407 19:19251033-19251055 CCTTGCCTTCCTCCCCCAAATGT 0: 1
1: 0
2: 1
3: 36
4: 438
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227
1163781410_1163781419 2 Left 1163781410 19:19251045-19251067 CCCCCAAATGTGCAACCTGTAAA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227
1163781413_1163781419 -1 Left 1163781413 19:19251048-19251070 CCAAATGTGCAACCTGTAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163781419 Original CRISPR GTCTCTCCACACCAGGGGCC AGG Exonic
900001674 1:17971-17993 GTCTCTGCAGGCCAGGGTCCTGG + Intergenic
900021394 1:188494-188516 GTCTCTGCAGGCCAGGGTCCTGG + Intergenic
900109945 1:1001191-1001213 GGGTCTCCACACCCGGGCCCAGG - Intergenic
900178182 1:1299790-1299812 CTCCCTGCACACCAGGCGCCTGG - Intronic
900337802 1:2173354-2173376 GTCTCACCTCAGCAGGGACCAGG + Intronic
900457235 1:2783229-2783251 CCCTCTCAACACCGGGGGCCAGG + Intronic
901741069 1:11342392-11342414 GCCTCTGCACACCAGGTCCCAGG + Intergenic
901826476 1:11865188-11865210 GTCTCTCAACAGCAGGGGCATGG + Intergenic
903070116 1:20722885-20722907 GTCTCTCCGCAACAGGGCCAGGG + Exonic
905892081 1:41523991-41524013 CTTTGTCCACACCAGGGGCCTGG + Intronic
907045455 1:51297566-51297588 GTGTCTCCACGTCAGGGGCAGGG - Intronic
907341288 1:53738099-53738121 GTCTCCCCTCCCCAGGAGCCCGG - Intergenic
908425525 1:64003598-64003620 GCCTCTCCACACTAGGGACTCGG - Intronic
913319415 1:117577935-117577957 GGGTCTCCAAACCATGGGCCTGG - Intergenic
913385040 1:118250397-118250419 TTCTCTCCAGAGCAGGGGTCAGG - Intergenic
916211623 1:162364444-162364466 GTTTCTTCAAACCAGGGTCCTGG + Intronic
917310115 1:173669810-173669832 GACTCACCACACCCGGGCCCCGG + Exonic
919803548 1:201367514-201367536 CTCTGTCCAGACCAGGGGGCTGG + Intronic
920036531 1:203069117-203069139 GCCTCTCCACACCAGGGCTTTGG + Intronic
920514208 1:206572464-206572486 GTCTGTCCAGACCTGGGGCTAGG + Intronic
922609351 1:226912949-226912971 TTCTCTCCCTCCCAGGGGCCAGG + Intronic
922988138 1:229882646-229882668 TGCTCTCCACCCCAGGAGCCAGG + Intergenic
923556758 1:235007147-235007169 GTCCGTGCACACCATGGGCCAGG + Intergenic
1064324212 10:14333564-14333586 GCCTCACCACCCCAGGGCCCAGG - Intronic
1065343757 10:24728541-24728563 GGCCTTCCACACCAGGGGCTGGG - Intergenic
1066649121 10:37638966-37638988 GTCTCTCCACACCACTGCCATGG - Intergenic
1067031975 10:42884379-42884401 GTCTCTCCACACCACTGCCATGG - Intergenic
1067119202 10:43459523-43459545 GTCTCAGCAAACCAAGGGCCAGG - Intronic
1067452580 10:46391315-46391337 GGGTCTCCACAAGAGGGGCCAGG + Exonic
1067584652 10:47468440-47468462 GGGTCTCCACAAGAGGGGCCAGG - Exonic
1069800820 10:71080495-71080517 GGCTCCCCACATCAGGGTCCAGG + Intergenic
1069824407 10:71246352-71246374 GGCTCTCCACACCCAGGGGCAGG + Intronic
1070564501 10:77593303-77593325 GTCTCTCCCTTCCAGGCGCCAGG + Intronic
1073064396 10:100749734-100749756 GTCTCTCCCCAGCAGGGCACGGG + Exonic
1073299568 10:102462595-102462617 GTCTTTACCTACCAGGGGCCTGG + Intronic
1073443318 10:103565422-103565444 CTCTCTCCATACCTGGGGCAGGG + Intronic
1074104143 10:110376259-110376281 GTCTCTCCAGGCCGTGGGCCAGG - Intergenic
1074282041 10:112061731-112061753 GTCTCTCTACACTAGGGATCTGG + Intergenic
1075072062 10:119326190-119326212 GCCTTCCCACAGCAGGGGCCAGG - Intronic
1075073327 10:119333547-119333569 GTCACTCCAGACCAGGGACCTGG - Intronic
1075481968 10:122789734-122789756 CTCTGTCCCCAGCAGGGGCCTGG + Intergenic
1076687767 10:132205806-132205828 GTCTCTGCACAGGCGGGGCCTGG + Intergenic
1076726561 10:132416709-132416731 GTCCTTCCACACCATGAGCCCGG + Intronic
1077018146 11:406052-406074 GTCTCCCCACCCCAGGTGTCCGG - Exonic
1078132075 11:8621270-8621292 TTCCCTCCAGACCTGGGGCCTGG + Exonic
1078489900 11:11759082-11759104 GTCTCTACACACCAGAGGGTCGG + Intergenic
1079416045 11:20237659-20237681 GTCTCTAGACACCTGGGGCCAGG - Intergenic
1080681760 11:34483354-34483376 GTCTGTGCACACGAGGGGGCAGG + Intronic
1084658274 11:70531947-70531969 GTCACTACACACCACGGTCCAGG - Intronic
1084688981 11:70714016-70714038 CTCCCTCTACCCCAGGGGCCAGG + Intronic
1084872205 11:72105921-72105943 CTCCCTCCACCCCAGGGCCCAGG + Exonic
1085784759 11:79439918-79439940 GCCTCTCCTCACCGGGCGCCCGG - Intronic
1088135566 11:106552290-106552312 GTCTCTGCACTCTCGGGGCCAGG + Intergenic
1088484218 11:110325426-110325448 GTCTCTGCCCACCAGGGTCTCGG + Intergenic
1088972590 11:114786942-114786964 GTCTCACCAGACCAGGGACCTGG - Intergenic
1089534405 11:119151794-119151816 GTCTCTCCAGCCCAAGGGCCTGG + Intronic
1089590922 11:119540328-119540350 GCCTATCCTGACCAGGGGCCAGG + Intergenic
1090156464 11:124443296-124443318 GTCTCTCCACAGCAGGAACCTGG - Intergenic
1090399277 11:126438479-126438501 GCCTCTACACACCCGGTGCCAGG + Intronic
1090974852 11:131672105-131672127 GGCTTTCCACACCATGGGTCCGG + Intronic
1091084068 11:132703683-132703705 CTCTCTGCAGACCAGGTGCCAGG - Intronic
1091374758 12:18093-18115 GTCTCTGCAGGCCAGGGTCCTGG + Intergenic
1091791408 12:3274143-3274165 GCCTCTACTCACCAGGTGCCAGG + Intronic
1092246327 12:6866374-6866396 CTCCCTCCACACCAGGGGGCTGG - Exonic
1092857519 12:12688744-12688766 GTAACCCCACAGCAGGGGCCAGG + Intronic
1096763901 12:53867535-53867557 GTGTCTCCTCCTCAGGGGCCAGG + Intergenic
1101029537 12:100645758-100645780 GTCTCTTCCCAGCAGGGGCAAGG + Intergenic
1102262845 12:111455305-111455327 GTCCCTGCACTCCAGGGCCCAGG - Intronic
1103428126 12:120856469-120856491 TCATCTCCACACCAGTGGCCAGG - Intronic
1104985332 12:132593382-132593404 GGCCCTCCACACCAGGGAACAGG - Intergenic
1106076375 13:26464692-26464714 GGGTATCCACTCCAGGGGCCAGG - Intergenic
1106490706 13:30218806-30218828 GTGACTCCACAGCTGGGGCCTGG - Intronic
1108268905 13:48739288-48739310 GTCTCTCCTCACTAAGGACCAGG + Intergenic
1110762799 13:79249100-79249122 GACTCTCCACACCAAGTGCTGGG + Intergenic
1113812837 13:113152996-113153018 GTCTCTCCTCCCCACTGGCCCGG - Intergenic
1114556692 14:23566313-23566335 GTTTCTCCACCTCTGGGGCCAGG + Exonic
1118747008 14:68781564-68781586 CTCTCTGCAGCCCAGGGGCCTGG - Intergenic
1119085284 14:71733359-71733381 GTCTGTCCACAGCAGGGCCTAGG - Intronic
1119416865 14:74476749-74476771 GGCTCTCCAAACCAGGGGTTTGG - Intronic
1121224103 14:92308654-92308676 ATAACTCCACAGCAGGGGCCAGG - Intergenic
1121266006 14:92603085-92603107 GTCTCCACCCACCAGGGCCCTGG - Intronic
1121328757 14:93036621-93036643 GGCTCAGCACCCCAGGGGCCGGG + Intronic
1125609387 15:40960435-40960457 GTCTCTCATCAGCAGGGGACAGG + Intergenic
1127806571 15:62526529-62526551 GGCATTCCAAACCAGGGGCCTGG - Intronic
1128707768 15:69850376-69850398 GCCCCTCCCCACCAGGGGCAAGG + Intergenic
1129688973 15:77702433-77702455 CACCCTCCACCCCAGGGGCCTGG + Intronic
1130078158 15:80708025-80708047 GTCCTTCCACACCTGGGCCCCGG + Intronic
1130557006 15:84929915-84929937 GGCTCTCCTGACCAGGTGCCTGG + Intronic
1131257665 15:90872376-90872398 GGGTCTGCACCCCAGGGGCCAGG - Intronic
1132222626 15:100116542-100116564 GTCCCTCCACACATGGCGCCAGG + Intronic
1132451835 15:101972969-101972991 GTCTCTGCAGGCCAGGGTCCTGG - Intergenic
1132455057 16:17660-17682 GTCTCTGCAGGCCAGGGTCCTGG + Exonic
1132570563 16:642234-642256 GTCTCACCTCGACAGGGGCCAGG - Exonic
1132586371 16:707269-707291 CTCTCACCACAGCAGGTGCCAGG + Intronic
1132689660 16:1176836-1176858 GTCTCTTCACCCCAGGGGACGGG + Intronic
1134228651 16:12412047-12412069 CTGTCTCCCCACCAGGTGCCAGG - Intronic
1134871121 16:17653341-17653363 TTCTCTTCCCACCAGGGGCTTGG + Intergenic
1138200975 16:55088118-55088140 GTTTCCCCAGACCATGGGCCAGG - Intergenic
1141280992 16:82629199-82629221 GTGTCTCCTCACCCAGGGCCAGG + Intronic
1141982510 16:87559277-87559299 GTCTCCAGAAACCAGGGGCCCGG - Intergenic
1144342058 17:14318208-14318230 GCCTCTCCACACCATCGGGCTGG - Intronic
1144652235 17:17014394-17014416 GTCTCTCCCCACCGGGGTCACGG - Intergenic
1145900606 17:28488367-28488389 GTATCCCCTCTCCAGGGGCCGGG - Intronic
1148792587 17:50181911-50181933 TTCTCTCCAGACTAGAGGCCAGG - Intergenic
1149964220 17:61145891-61145913 GTCTCTGCAAACAAGTGGCCTGG - Intronic
1150210445 17:63438563-63438585 TCCCCTCCACACCAGGGGCGGGG + Intronic
1150488550 17:65560209-65560231 GCCTCTCCGCAAAAGGGGCCGGG + Intronic
1151647443 17:75442963-75442985 GTCTTTCCACACCAGAAGTCAGG - Intronic
1151842639 17:76628771-76628793 CGCTGTCCACACCAGGGGTCCGG + Intronic
1151931619 17:77235732-77235754 GTCCATCAACTCCAGGGGCCCGG - Intergenic
1152257123 17:79246608-79246630 GGCTCTCCACACCCGGGAGCAGG - Intronic
1152284484 17:79404278-79404300 GTCCCAGCCCACCAGGGGCCTGG + Intronic
1152629381 17:81403239-81403261 GCCTCCCCTCTCCAGGGGCCAGG + Intronic
1153118017 18:1684527-1684549 GTCTCAACACACTAGTGGCCAGG + Intergenic
1156244518 18:35284691-35284713 ATCTCTGCACTCTAGGGGCCTGG - Intronic
1158426849 18:57348000-57348022 GTCTCACCTCCCCACGGGCCTGG + Intergenic
1159848975 18:73503195-73503217 GTCTGGCCACACCAGGGCCCAGG + Intergenic
1160059758 18:75518276-75518298 GTCACTCCTCACCAGAGTCCTGG - Intergenic
1160392808 18:78547903-78547925 GGACCCCCACACCAGGGGCCCGG - Intergenic
1161218402 19:3106187-3106209 GTCTCTGCTGACCAGGGCCCTGG + Intronic
1161298453 19:3531610-3531632 CTCTCTCCTCACCAGGGCTCTGG - Intronic
1161444390 19:4310329-4310351 CTGTCTTCACACCAGGGGCAGGG - Intronic
1161569884 19:5024605-5024627 GACCCTGCACACCACGGGCCAGG - Intronic
1162786882 19:13040561-13040583 GTCTGTCCATACAAGGAGCCTGG - Intronic
1162823518 19:13237279-13237301 GTCTCTCCACACTAAGGGAAGGG + Intronic
1162936456 19:13983945-13983967 GACTGTCCACTCCAGGGTCCTGG + Intronic
1163184020 19:15623803-15623825 GTCTCTCCACTCCAGGGAAGTGG + Intronic
1163472608 19:17506052-17506074 GCCCCACCACTCCAGGGGCCAGG - Exonic
1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG + Exonic
1163822741 19:19505517-19505539 GTCCTTCTAGACCAGGGGCCAGG - Exonic
1167512542 19:49903410-49903432 GCTTCTGCACACCAGGGCCCTGG - Intronic
1167527424 19:49993814-49993836 GACTCTCCACCCCCGGGGCCCGG + Intronic
1168474399 19:56665437-56665459 GTCTCTCCACACTGGCTGCCAGG + Intronic
925003672 2:426032-426054 GTCTCTTCACTCCGGGGCCCAGG + Intergenic
925410725 2:3638468-3638490 GTCTGTCCAATTCAGGGGCCAGG + Intronic
926154564 2:10446281-10446303 GTGCCACCACACCCGGGGCCTGG + Intronic
926700392 2:15799650-15799672 GTCTCTGCACATCTGGTGCCTGG - Intergenic
931570387 2:63662972-63662994 GTCTCTCAACAACAGTGGCATGG - Intronic
933123734 2:78576589-78576611 ATGCCTCCCCACCAGGGGCCTGG + Intergenic
933771698 2:85748761-85748783 ATATCTCCACACCATTGGCCAGG - Intergenic
936568049 2:113595437-113595459 GTCTCTGCAGGCCAGGGTCCTGG - Intergenic
937356423 2:121200799-121200821 TTCCCTCCAGACCAGGGGCATGG - Intergenic
940792285 2:158042084-158042106 TTCTTTGCAGACCAGGGGCCAGG + Intronic
942551468 2:177124195-177124217 GACTCTCCACAGGAGGGTCCTGG - Intergenic
946399384 2:219460685-219460707 CCCCCTCCACACCAGGGCCCAGG + Intronic
946409629 2:219509590-219509612 CTCCCTCCACACCAGAGCCCAGG - Intergenic
946423957 2:219582215-219582237 GTCTCTCCACAGGAGGGGAAGGG + Intergenic
1169811091 20:9610068-9610090 CTATCTTCACACCAGGGGGCAGG - Intronic
1170656209 20:18289314-18289336 GCCTGGCCACACCAGGGGCCTGG - Intronic
1171406981 20:24918168-24918190 GATTCTCCACGCCAGAGGCCCGG + Intergenic
1173332691 20:42088264-42088286 GTCTCTCCTCAGCGGGGGTCTGG + Intronic
1174212633 20:48892024-48892046 GTCTCTACCCACTAGGTGCCAGG + Intergenic
1174449711 20:50611684-50611706 GTCTATCCATTCCAGGGGCCAGG + Intronic
1175269821 20:57725849-57725871 GTCTCCCCACACTAGCTGCCTGG - Intergenic
1176101763 20:63367672-63367694 TTCACACCACATCAGGGGCCGGG + Intronic
1176299116 21:5090296-5090318 GCCTCTCCCCGCCAGGGACCAGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179593608 21:42427708-42427730 GTTTCTCCGCACCAGGGGCCTGG - Intronic
1179991391 21:44949853-44949875 GTCCCTCCACCGCAGGTGCCTGG - Intronic
1181014406 22:20060998-20061020 GGCTCTCCTAACCTGGGGCCTGG + Intronic
1183389990 22:37540208-37540230 TTCTCTCCACGCCAGGTGCAGGG - Intergenic
1183690154 22:39383689-39383711 GTATCTCCAGCACAGGGGCCGGG - Exonic
1183974809 22:41505489-41505511 GTCTCTCCACACCTGGAATCTGG - Intronic
1183986119 22:41571614-41571636 TTCTCTTAACTCCAGGGGCCTGG - Intronic
1184102286 22:42347218-42347240 GTCTCCCCACAGCAGGGGTGAGG + Intergenic
1184251440 22:43262596-43262618 TTCTCTCCACCCCATGGGGCTGG + Intronic
1184279021 22:43426658-43426680 CTCTCCCCACAACAGAGGCCAGG - Intronic
1184616945 22:45644922-45644944 GCCTCTCCCCACCAGACGCCAGG + Intergenic
1184877030 22:47282600-47282622 GGCTCTCCACCCCTGGTGCCGGG - Intergenic
950674162 3:14544683-14544705 CTCCCTCCACCCCAGGGGCCGGG + Intergenic
953535879 3:43776365-43776387 CTCTCTCCATACCCTGGGCCCGG - Intergenic
953787090 3:45919538-45919560 GTCACTCCACAGCAGAGGACCGG - Exonic
954621930 3:52001425-52001447 TTCACTCCCCACCAGGAGCCTGG + Intergenic
955231450 3:57102437-57102459 GTCTCCCCACAACAAGGGGCAGG - Intronic
960789620 3:121414223-121414245 GTCTCTCCACACTAGCAGGCAGG - Intronic
961383448 3:126510530-126510552 GTCTGTCCAGACCAGGAGGCAGG - Intronic
961529231 3:127529767-127529789 ATCACTCCACACCAGGATCCAGG + Intergenic
962793835 3:138834432-138834454 GTCTCTGCCGCCCAGGGGCCGGG + Intronic
964339702 3:155695623-155695645 GTCTCTCCAACCCAAGGTCCAGG - Intronic
964990779 3:162809151-162809173 GACACTCTACACCAAGGGCCAGG + Intergenic
966771632 3:183509598-183509620 GGCTCTTCATTCCAGGGGCCAGG + Intronic
968745146 4:2356133-2356155 CTCTCCCCACCCCAGGGGTCTGG - Intronic
969592655 4:8130723-8130745 GTCTCTCCCCTCCCTGGGCCTGG - Intronic
972670044 4:41206496-41206518 GTCTCTCTTCACCAGTGTCCTGG + Intronic
973107317 4:46356368-46356390 GTCTCTCCACACCCCTGGCCAGG + Intronic
979748637 4:124248010-124248032 AACTCTCCAAACCCGGGGCCAGG - Intergenic
980876860 4:138670400-138670422 CTCTCTCCAAACCAGGCCCCAGG + Intergenic
981502669 4:145469281-145469303 GCCTCTCCACAAAAGGGGGCAGG + Intergenic
986070074 5:4274211-4274233 GTCTCTCCACTCCACTGGCTAGG - Intergenic
986127127 5:4893510-4893532 GTGTCGCCTCACCAGGGGTCAGG - Intergenic
997382714 5:133449167-133449189 GTCTGTGCACACCATAGGCCTGG + Intronic
998388116 5:141769874-141769896 GAGACTCCACACCAGGGGACTGG - Intergenic
998423298 5:142006556-142006578 GTAACTGCACACCAAGGGCCTGG + Intronic
1001096029 5:168776137-168776159 GTCTCTCCATACCAGGATCCAGG + Intronic
1001944893 5:175770712-175770734 GTCTCTAGACACCAGTGGGCAGG - Intergenic
1001960972 5:175880270-175880292 GTCTTTCCCCAGCAGGGGTCAGG + Exonic
1002447425 5:179297987-179298009 GTCCCTCCTCCCCAGGGCCCCGG + Intronic
1002508925 5:179699746-179699768 CTCTTTCCACACCGGAGGCCTGG + Intronic
1002643514 5:180641598-180641620 CTCTCTTCACTCCTGGGGCCAGG + Intronic
1002764122 6:225154-225176 GACTCTACACACCTGGCGCCTGG - Intergenic
1003242013 6:4353244-4353266 GTGTTTGCAGACCAGGGGCCTGG - Intergenic
1003410946 6:5862603-5862625 CTCTCTTCACACCAGAGGTCTGG - Intergenic
1003565600 6:7219759-7219781 GGCTGCCAACACCAGGGGCCGGG - Intronic
1006037164 6:31222908-31222930 GACTCCCCTCACCAGGGCCCTGG + Intergenic
1006335272 6:33417303-33417325 GTCTCTTCACTCCAGGGCCGTGG - Exonic
1011387611 6:86815085-86815107 GTGTCTCCTCATCAGGAGCCAGG + Intergenic
1014045121 6:116876729-116876751 GTCTTTGCACAGCAGGGACCGGG - Intergenic
1015825215 6:137303931-137303953 CTCTCTCCACAACAGAGGGCAGG + Intergenic
1018214986 6:161518175-161518197 GTGACTCCACACCATGGGGCCGG + Intronic
1018939325 6:168297917-168297939 ATCACTCCTCACCAGGGGCTGGG - Intronic
1019312624 7:370062-370084 GACTCCCACCACCAGGGGCCTGG + Intergenic
1022667754 7:32427971-32427993 GTCTCCCCACGCCGGGGTCCCGG + Intergenic
1023879172 7:44308829-44308851 GTCTCTCCTCACAAGAGACCAGG + Intronic
1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG + Intergenic
1025991119 7:66497718-66497740 GTCGCTGCACACCAGCAGCCTGG - Intergenic
1027180471 7:75935787-75935809 GTGCCTGCACACCAAGGGCCTGG - Intronic
1029113354 7:98224378-98224400 GTCCCTCAACACTAAGGGCCTGG + Intronic
1034193035 7:149225538-149225560 GTCACTGCACAACAGTGGCCTGG + Exonic
1035352613 7:158257190-158257212 GTCTCTCCACACGCTGGTCCAGG - Intronic
1036279700 8:7390124-7390146 AGCTCTCCAGACCAGGGGTCAGG - Intergenic
1036341819 8:7921759-7921781 AGCTCTCCAGACCAGGGGTCAGG + Intergenic
1040551935 8:48444485-48444507 GTCTCTTCATTCCGGGGGCCTGG + Intergenic
1040801927 8:51351542-51351564 GTCTCCCCACTCCAGAGGCTGGG - Intronic
1041936022 8:63332558-63332580 GACTGTCCACCCCAGAGGCCAGG - Intergenic
1047785159 8:128147086-128147108 GTCTCTGCAGGTCAGGGGCCTGG + Intergenic
1049361963 8:142216160-142216182 GTCTCTTCACCCCCAGGGCCCGG + Intronic
1049366063 8:142237442-142237464 GCCTCTCCACCCAAAGGGCCTGG + Intronic
1049432444 8:142571588-142571610 GTCACTCTCCACCTGGGGCCAGG + Intergenic
1049884482 9:18084-18106 GTCTCTGCAGGCCAGGGTCCTGG + Intergenic
1052865739 9:33463725-33463747 GTCTCACCAAACAAGGGGACCGG + Intronic
1058161814 9:101578488-101578510 GTCTCACCACAGGAGAGGCCAGG + Intronic
1059191554 9:112332855-112332877 CTTTCTCGACACCAGGGGTCTGG - Exonic
1059422230 9:114199446-114199468 GTTTCTACACAGCGGGGGCCAGG - Intronic
1060197309 9:121632034-121632056 GTCTCTCCCCACGAGGACCCTGG - Intronic
1061195172 9:129103461-129103483 ATCACACCACCCCAGGGGCCCGG - Intronic
1061548662 9:131319718-131319740 GCCCCTCCCCACCAAGGGCCAGG - Intergenic
1062710761 9:137974019-137974041 GGCTCCCCACACGAGGGGCTCGG - Intronic
1185694483 X:2185027-2185049 GGATCTACACACCAGAGGCCAGG - Intergenic
1190995620 X:55605934-55605956 GTCTCTCCCCATCAGGAGGCAGG + Intergenic
1192576277 X:72245718-72245740 GTTTATCCATCCCAGGGGCCAGG - Intronic
1193108553 X:77704853-77704875 GTCTCTGCACTCTTGGGGCCTGG - Intronic
1198056775 X:133003595-133003617 GTCTCTTTACCCCAGGGCCCTGG + Intergenic
1199425204 X:147693080-147693102 GTGACTCTACGCCAGGGGCCAGG + Intergenic
1200401324 X:156022067-156022089 GTCTCTGCAGGCCAGGGTCCTGG - Intergenic
1200792571 Y:7312724-7312746 GGCTCCCCCCAGCAGGGGCCAGG + Intergenic