ID: 1163782394

View in Genome Browser
Species Human (GRCh38)
Location 19:19257394-19257416
Sequence AGTGAGATGCAGAAGGTGTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163782389_1163782394 12 Left 1163782389 19:19257359-19257381 CCCACGTGACCGCAAGGGACTAG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG 0: 1
1: 0
2: 4
3: 26
4: 287
1163782390_1163782394 11 Left 1163782390 19:19257360-19257382 CCACGTGACCGCAAGGGACTAGT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG 0: 1
1: 0
2: 4
3: 26
4: 287
1163782386_1163782394 19 Left 1163782386 19:19257352-19257374 CCAGTGTCCCACGTGACCGCAAG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG 0: 1
1: 0
2: 4
3: 26
4: 287
1163782391_1163782394 3 Left 1163782391 19:19257368-19257390 CCGCAAGGGACTAGTGTTCAGTC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG 0: 1
1: 0
2: 4
3: 26
4: 287
1163782385_1163782394 20 Left 1163782385 19:19257351-19257373 CCCAGTGTCCCACGTGACCGCAA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG 0: 1
1: 0
2: 4
3: 26
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163782394 Original CRISPR AGTGAGATGCAGAAGGTGTA CGG Exonic
901668748 1:10841728-10841750 ACTTAGATGAAGAAGATGTATGG - Intergenic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
903367847 1:22815933-22815955 TCTGAGAGGCAGAAGGTGTGTGG + Intronic
904694653 1:32322221-32322243 AGTCAGAGGCAGGAGGTGTGGGG - Intronic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905448259 1:38041493-38041515 AGTGAGATGCGGAAGGAGATGGG + Intergenic
905675206 1:39819743-39819765 AGTGAGAGGCAGGATGTGTTGGG + Intergenic
905879475 1:41454355-41454377 GGCGAGATGCATAAGGTGTCCGG + Intergenic
906097252 1:43232610-43232632 AGAGAGAGACAGAAGGTGTGAGG + Intronic
906418046 1:45637960-45637982 CGTAAGATGAAGAAGGTGTAAGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908023230 1:59920283-59920305 GGGGAAATGCAGAAGGTGTTTGG + Intronic
909591439 1:77353610-77353632 AGTGAGACGCAGAGTGGGTAAGG - Intronic
910623421 1:89281098-89281120 AGTGAGGTGCAGAAGAGGTTAGG - Intergenic
912744804 1:112237183-112237205 AGTGATATGCAGAAGGTCATTGG + Intergenic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
916807956 1:168278623-168278645 AGTCAGAGGAAGAAGATGTAAGG - Intergenic
919760755 1:201096584-201096606 GGTGGGAGGCAGAAGATGTATGG + Intronic
920649214 1:207824248-207824270 AGTGAGGTGCAGGAGGGGTGAGG - Intergenic
921487879 1:215736137-215736159 TGTGAGCTGCTGAAGGTTTAGGG - Intronic
923061603 1:230480399-230480421 TGTGAGATGCAGTATGTGTGTGG - Intergenic
1063988333 10:11532309-11532331 AGTTAGTTGCAGAATGTGTGAGG - Intronic
1065184819 10:23161489-23161511 AGTGAGCTGCAGAAGGATTTTGG + Intergenic
1069276770 10:66601519-66601541 ATTGAGATCCAGAAGCTATAAGG - Intronic
1069635386 10:69921855-69921877 AGGGAGATGCAGACAGTGTGGGG - Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1072900756 10:99404528-99404550 AGTGAGATGCAAAAGGATTTGGG - Intronic
1073131352 10:101191026-101191048 AGTGAGGTGCAGAAGATGCCGGG - Intergenic
1073538823 10:104301458-104301480 AGCGAGATGGAGGAAGTGTAAGG - Intronic
1073687007 10:105765819-105765841 AGAGAGATGCAGGAGGAGTCAGG - Intergenic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1074339738 10:112615858-112615880 AGTGAGGTGCACAGGGAGTAAGG + Intronic
1074404669 10:113170535-113170557 AGAGAGAGGCAGAAGGTGTCTGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075552037 10:123400007-123400029 AGTGAGATAGAGAAGGTGAGTGG - Intergenic
1077999058 11:7478538-7478560 AGTGAGCTGCAGAAAGTGTTGGG + Intergenic
1079082962 11:17427067-17427089 GGGGAGATGCAGAAGGTCTCAGG - Exonic
1079673112 11:23192344-23192366 AGGGAGATGAAGAAGAAGTATGG + Intergenic
1079673113 11:23192371-23192393 AGTAAGATGAAGAAGAAGTATGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081246495 11:40772456-40772478 AGTAAGAAGCAGAATGTATAAGG + Intronic
1081607390 11:44535937-44535959 AGTGAGTTGGAGAAGGAGTTTGG + Intergenic
1086094054 11:83032948-83032970 AGTGAGATGCTTAAGATGTCGGG - Intronic
1086247130 11:84766938-84766960 AGTGAGATGCACATGGTCTTTGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087131638 11:94673859-94673881 AGTGAGCTGCAGATGGTCAATGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090987737 11:131786560-131786582 AGTAAAATACAGAAGCTGTAGGG + Intronic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091466239 12:687254-687276 AGAGAGATTCAAAAGGTGTGAGG + Intergenic
1091491569 12:937094-937116 AGTGAGATACAGAAGCTGAGGGG + Intronic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1093092587 12:14938057-14938079 AGAGAGAAGCAGAAGATGTCAGG + Intronic
1094552863 12:31469449-31469471 AGAGAGGTGCAAAAGGTGTAGGG - Intronic
1095283379 12:40383304-40383326 AGTGAGATGCAGATGAAATAGGG - Intergenic
1095423986 12:42055530-42055552 AATGAGAAGCTGAAGCTGTATGG + Intergenic
1096267385 12:50134597-50134619 GATGACATGCAGAAGCTGTAGGG + Exonic
1096691028 12:53321807-53321829 AGTGAGTGGGAGAAGGTGTTCGG - Intronic
1096804006 12:54129333-54129355 AGTGAGATAAAGAAGGAATAAGG + Intergenic
1097398434 12:59103054-59103076 AGAGACATGGAGAAGGGGTAGGG - Intergenic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1098534434 12:71578464-71578486 AGTGAGAGGTAAAAAGTGTAGGG - Intronic
1098828230 12:75326888-75326910 AGTGAGACAGAGAAGATGTAAGG + Intronic
1100811099 12:98339091-98339113 AATGAGATGTTGATGGTGTATGG + Intergenic
1101917673 12:108908568-108908590 AGTGAAATGGAAAAGGTGTAAGG - Intergenic
1102350929 12:112191491-112191513 AGTGAGAGGAAGAAGGTCCAAGG + Intronic
1102969387 12:117154263-117154285 AGTGTGATGGGGATGGTGTAAGG - Intronic
1103019994 12:117526236-117526258 AGTTAAATGCTCAAGGTGTAGGG + Intronic
1103221883 12:119253099-119253121 GGTGAGATGGAGAAGGTCCAGGG - Intergenic
1104466774 12:128996813-128996835 AGTGGGATGCAGGAGGGGCAGGG + Intergenic
1104521518 12:129480200-129480222 AGGGAGAGGAAGAAGGTGCATGG + Intronic
1105054479 12:133084874-133084896 AGTGAGATGGAACAGGTGCAGGG + Intronic
1106444360 13:29811966-29811988 AGTGAGATGGAGCCGGAGTAAGG - Intronic
1106693185 13:32141856-32141878 GGTGAGATGCAGAGGGTCCAGGG + Intronic
1110666924 13:78127777-78127799 AGTGAGATGAAGGAGGTATCAGG - Intergenic
1110738338 13:78964794-78964816 CGTAAGATGGAGAAGGTGTGTGG + Intergenic
1111587753 13:90304762-90304784 ATGGAGATGCAGTAGGTATATGG - Intergenic
1113356191 13:109582694-109582716 AAGGAGATGCAGAAGGTGTTTGG + Intergenic
1115608385 14:35028530-35028552 AGTGAGGTTCAGAAAGTTTAAGG - Intronic
1115899159 14:38125783-38125805 AGTGAGATGCAGAACATGTAAGG + Intergenic
1117539128 14:56729569-56729591 AGCGAGAAGCAGAGAGTGTATGG + Intronic
1119966517 14:78922511-78922533 ATTTAGATGCAGATGGTATAAGG + Intronic
1119978839 14:79056773-79056795 AGTGAGATGGACAAGGCATAAGG + Intronic
1120533849 14:85667993-85668015 AGTCAGATTTAGAAGGTGTTAGG - Intergenic
1123709722 15:22978937-22978959 AGTGAGCTGTAGCAGGTGCATGG - Intronic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125998842 15:44190088-44190110 AGTGAGAAACAGAAGCTATAAGG + Intronic
1126054443 15:44716518-44716540 AGTGGCATGAAGAAGGTGTATGG + Intronic
1128796447 15:70469993-70470015 AGCCAGATGCAGAGGGTGCACGG + Intergenic
1131143104 15:89993524-89993546 AGGGAGATAAAGAGGGTGTAGGG - Intergenic
1131771495 15:95742752-95742774 AATGAGAGACAGAAGATGTAAGG - Intergenic
1132867876 16:2102817-2102839 GGGGAAATGAAGAAGGTGTAGGG + Exonic
1134038003 16:11046507-11046529 AGAGAGATGCAGCAGTTCTAAGG + Intronic
1134523897 16:14930297-14930319 GGGGAAATGAAGAAGGTGTAGGG - Intronic
1134549007 16:15130638-15130660 GGGGAAATGAAGAAGGTGTAGGG + Intronic
1134711488 16:16328782-16328804 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134719339 16:16372081-16372103 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134948087 16:18339804-18339826 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1134955341 16:18379911-18379933 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1135191300 16:20356850-20356872 AGTCAGAGGAAGTAGGTGTAAGG + Intergenic
1135346888 16:21696369-21696391 ATTTGGATGCAGAAGGGGTAAGG + Intronic
1135390916 16:22092572-22092594 AGTGAGATCCAGGAGAAGTAAGG + Exonic
1135823053 16:25701601-25701623 AGGGAGGTGCAGAGGGTGTTTGG + Intronic
1135825908 16:25728740-25728762 ACTGAGAAACAGAAGATGTAAGG - Intronic
1137251043 16:46741109-46741131 AGTGAGATGCAGAGAATTTAAGG - Intronic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1140681213 16:77386576-77386598 TGAGGGATGCAGAAGGGGTAGGG - Intronic
1140802163 16:78498484-78498506 ACTGAGAAGCACAAGGTGTGAGG + Intronic
1140954565 16:79849916-79849938 AGTGAGATGTGGAAGTTGAAGGG - Intergenic
1141348991 16:83275541-83275563 AGAGAGATGGAGAAGATGCAGGG + Intronic
1143892520 17:10113619-10113641 AGTGAGAGGCACAAGTTGTAGGG - Intronic
1143892683 17:10114782-10114804 AGTGAGAGGCACAAGTTCTAGGG - Intronic
1144699080 17:17325050-17325072 TGTCTGATTCAGAAGGTGTAGGG - Intronic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1150635616 17:66911250-66911272 GCTGAGATGGAGAAGGTGTTGGG - Intergenic
1150965643 17:69964929-69964951 AGGCAGATGCAGAAGATGAAAGG - Intergenic
1151059241 17:71071885-71071907 AGTGAGACCCAGAAGGTAGAGGG + Intergenic
1151508892 17:74546356-74546378 AGGGACATGCAGATGGTGTCTGG - Intergenic
1152066692 17:78115986-78116008 AGTGAGTTGCAGAAGGGGGTCGG - Intronic
1154294958 18:13139728-13139750 AGTGAGATCCAGAAGGTTCCAGG + Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1158753260 18:60291141-60291163 GGTGAGATGTAGAAGGGATATGG + Intergenic
1159159049 18:64620397-64620419 AGTGAGATGGAGAATATGAATGG - Intergenic
1160420632 18:78741618-78741640 AGTGCGATGGAGAAGGTAGAGGG + Intergenic
1161446030 19:4319684-4319706 AGGGAGAAGCAGAAGATATAGGG + Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164464618 19:28476777-28476799 AGTGTGATTCAGCAGGTGGAGGG - Intergenic
1164943060 19:32266558-32266580 ATTGAGCTGCAGAACGTGAACGG + Intergenic
1166382485 19:42362235-42362257 GATGAGAAGCAGCAGGTGTAGGG + Intronic
1166953389 19:46445478-46445500 AGTGAGATGAGGAAGCTCTAGGG + Intergenic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
926331536 2:11829753-11829775 GGTGAGATTCAGCAGGTCTAGGG - Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
927305960 2:21573137-21573159 AGTAAGATACAGAAGGGCTAAGG + Intergenic
928021382 2:27707794-27707816 GGTGAGAATCAGAAAGTGTATGG + Exonic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
930353551 2:50288919-50288941 AGTCAGATGCAGAGATTGTAGGG + Intronic
931339232 2:61382492-61382514 AGTGTGATACAGAGGGAGTATGG - Intronic
931908561 2:66869428-66869450 AGGGAACTGCAGAAGGAGTAAGG + Intergenic
933141126 2:78793856-78793878 AGTGAGAGGCTGAAGCTGGATGG + Intergenic
933652514 2:84860833-84860855 GGTGAGGTGGAGAAGGTGTGTGG + Intronic
934884225 2:98010452-98010474 AGTGAGAAGCAGAAGGTGTGTGG - Intergenic
937849833 2:126622136-126622158 AGTGAGAGGCACTAGGTGTGTGG + Intergenic
938034641 2:128026868-128026890 GGGAAGATGGAGAAGGTGTAGGG - Intronic
938337945 2:130515739-130515761 AGTGAGACTCAGAGGGTGCATGG - Intergenic
938351894 2:130604999-130605021 AGTGAGACTCAGAGGGTGCATGG + Intergenic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
939271528 2:139945728-139945750 AGTGAGATGGAGAAAATTTAAGG - Intergenic
941336196 2:164246550-164246572 TGTATGATTCAGAAGGTGTATGG + Intergenic
941499276 2:166249254-166249276 AGTGCTATGGAGAAGGTATATGG - Intronic
942672595 2:178392366-178392388 TGTGAGAGGCAGAAGGTTTATGG - Intronic
943070033 2:183130237-183130259 ACTCTGATTCAGAAGGTGTAGGG - Intronic
947682770 2:232050882-232050904 ACAGAGATGAAGGAGGTGTATGG + Intronic
947768488 2:232652782-232652804 AGTGAGATGATGAAGATGTGAGG + Intronic
948386600 2:237584656-237584678 AGAGAGAGGCAGCAGGTGTCAGG - Intronic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG + Intergenic
1169413737 20:5397265-5397287 ACTGAGTTGCAAAAGGTTTAGGG - Intergenic
1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG + Intronic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175600296 20:60267348-60267370 AGTGAGATGGAGCAGGGGAAAGG + Intergenic
1175690191 20:61059683-61059705 GGTGAGAAACAGAAGGAGTAGGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1175977870 20:62721955-62721977 AGTGAGAAGCAGGAGGTGTCAGG - Intronic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1177299707 21:19226831-19226853 AGTGAGATTCACGAGGTCTAAGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1182003433 22:26939721-26939743 TGAGAGATGCAGGAGATGTAAGG - Intergenic
1183594070 22:38799300-38799322 AGTGAGATGCTGGAGGTATGGGG - Intergenic
1184542081 22:45132780-45132802 AGTGAGATGGTGAAGCTTTAAGG - Intergenic
951084041 3:18489618-18489640 AGTTAGGTGAAGAAGGTATAGGG + Intergenic
953510277 3:43529921-43529943 ATTGAGATGCAGAATATGTTTGG - Intronic
953792898 3:45962075-45962097 AGTGAGATGGAGAAGGAGAGAGG + Intronic
954025898 3:47782580-47782602 AGCGCTATGCAGAAAGTGTATGG - Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
956499062 3:69862155-69862177 AGTGAGATTCTGCAGGGGTATGG - Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956748039 3:72324912-72324934 AGGGAGTTGCAGAGAGTGTAGGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
960024910 3:112998065-112998087 AGTGAGAAGCAGAAAGTGTGTGG - Intronic
961014934 3:123460414-123460436 ATTGAGATGCCGAAAGTGTTAGG + Intergenic
961379097 3:126485895-126485917 GGTGAGATGCAGGAGGGGCAGGG - Intronic
962025461 3:131542642-131542664 AGTGACATGCAGATGCTGGACGG - Exonic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
963056250 3:141188528-141188550 AGGGGTATGCAGGAGGTGTAGGG + Intergenic
963781546 3:149491729-149491751 TGTGAGATGGAGAAGGAGTGCGG + Intronic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964036097 3:152198696-152198718 ATTGAGACACAGAAGGTATATGG + Intergenic
964995939 3:162881358-162881380 AGTGAGATAGAGAAGGGGCACGG + Intergenic
966126291 3:176580597-176580619 AGTCAGATGCAGATGGTCTATGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967494484 3:190127644-190127666 AGTTAGAGCCAGAAGGAGTAAGG - Intergenic
967643989 3:191899903-191899925 AGAGACATGGAGAAGGGGTAGGG + Intergenic
969216450 4:5726411-5726433 AGAGAGATGCAGAGGATGTGGGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971556302 4:28016396-28016418 AGTGAAAAGCAGCAGGTGAAAGG + Intergenic
972020050 4:34301000-34301022 AGAGAGATGCTAAAGGTATATGG - Intergenic
972292689 4:37704609-37704631 GGTGGAAAGCAGAAGGTGTAGGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976911244 4:90308827-90308849 AGTGAGATGAAAAAGATTTAGGG - Exonic
978018850 4:103783901-103783923 AGTGAGCTGGAGAAAGAGTAGGG - Intergenic
979271551 4:118768251-118768273 AGTCAGATGCAACAGGTGCAAGG - Exonic
980843786 4:138299687-138299709 AGTGACTTGGAGAAGGTGTGGGG + Intergenic
981174138 4:141660921-141660943 ATAGAGATGATGAAGGTGTAGGG - Intronic
981811420 4:148780116-148780138 ACTGAGATGCTGATGGTGTGAGG + Intergenic
982084116 4:151817099-151817121 AGAGACATGGAGAAGGGGTAGGG + Intergenic
985024883 4:185731180-185731202 AGTCAAATGCAGAGGCTGTAAGG + Intronic
985964572 5:3330160-3330182 AGTGAGAACGAGAAGATGTAAGG - Intergenic
987379243 5:17269330-17269352 AGTGAGACTCAGAAGGTGATGGG + Intronic
989266017 5:39474975-39474997 ACTGGGATACAGAAGGTGTAGGG + Intergenic
990408472 5:55516133-55516155 GGTGACATGTTGAAGGTGTAGGG - Intronic
990701675 5:58481438-58481460 AGTGAGGGGCAGCATGTGTAGGG + Intergenic
990701718 5:58481718-58481740 AGTGAGGGGCAGCATGTGTAGGG + Intergenic
991617578 5:68513198-68513220 ACTGAGGTCCAGATGGTGTATGG - Intergenic
991644757 5:68790680-68790702 ACTGAGGTGCAGAAAGTTTAAGG - Intergenic
992075598 5:73190124-73190146 AGAAGGATGCAGAAAGTGTAAGG + Intergenic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
996698656 5:126426201-126426223 AGTGATATGCAGAAGGAATAAGG + Intronic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998429350 5:142057318-142057340 AGGGAGAGGCAGGAGGTTTATGG - Intergenic
999582734 5:153057723-153057745 CGTGTGATCCAGAAGGTGGAAGG + Intergenic
999935157 5:156478543-156478565 AGCCAGATGTAGAAGGTGAATGG - Intronic
1001149020 5:169210603-169210625 AGTGGTATGCAGAATGTGTTGGG + Intronic
1002514502 5:179747310-179747332 AGTGAGAGTCAGAAGCTGTATGG + Intronic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003135697 6:3433337-3433359 AGTGAGTCCCAGAAGCTGTAGGG + Intronic
1003142506 6:3483130-3483152 TGTGAGAGGCAGGAGCTGTAAGG - Intergenic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003276088 6:4654341-4654363 AGGGACATGCAAAATGTGTAAGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1005869361 6:29962780-29962802 TGTGAGATGTATAGGGTGTAGGG - Intergenic
1006994475 6:38245509-38245531 AGAGGGATGCAGAGGGAGTATGG + Intronic
1007952601 6:45885640-45885662 AATGAGATTCAGAAGATGTCCGG - Intergenic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1011832856 6:91394164-91394186 AGTGAGATGCATATGGAGTATGG - Intergenic
1012157301 6:95835603-95835625 AGAGAGAGGTAGAAGGTGTGGGG - Intergenic
1012261000 6:97087557-97087579 AGTGTGAAGCAAAAGGTGTTGGG + Intronic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1012509672 6:99988713-99988735 AGTGAGAGGCAGAGGGTAAAAGG - Intronic
1014743939 6:125177607-125177629 AATGTGCTGCAGAAGGTGAAGGG - Intronic
1015867112 6:137738821-137738843 ACTGAGATCCAGAAGGGTTAGGG + Intergenic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1020071560 7:5230270-5230292 TGTGAAGTGCAGAAGCTGTAGGG + Intronic
1020185845 7:5958889-5958911 AGTAAGATGCAAAAGTTGCACGG - Intronic
1020297071 7:6765873-6765895 AGTAAGATGCAAAAGTTGCATGG + Intronic
1020699345 7:11459220-11459242 ATTGAGGTCCAGAAGGTGAAGGG + Intronic
1021028983 7:15705777-15705799 AGTGGCCTGCAAAAGGTGTATGG + Intergenic
1022521908 7:31013861-31013883 GGTGGGATGCATAAGGTGAATGG - Intergenic
1023238536 7:38116714-38116736 GGTGAGACCCAGAAGGTCTAAGG - Intergenic
1023325077 7:39045467-39045489 AGAGAGATCAAGAAGGTTTATGG - Intronic
1023600209 7:41875073-41875095 AGTGTGTTGAAGAAGGAGTAGGG + Intergenic
1023665457 7:42518303-42518325 AATGAGAGGAAGAAGGTCTAAGG + Intergenic
1028331303 7:89596453-89596475 AGTGAGAGGGAGAAGTGGTAAGG - Intergenic
1028380953 7:90197877-90197899 AGTGAGAGAGAGAAGGAGTAAGG - Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030840258 7:114343208-114343230 AATAAGATGTAGAAGATGTAGGG - Intronic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1034879239 7:154750853-154750875 AGTGGGAGGCTGCAGGTGTAAGG + Intronic
1035088977 7:156289103-156289125 AGAGAGAGGCAGAATGTGTTTGG - Intergenic
1035847332 8:2879353-2879375 AATGAGATGCAGCAGATTTATGG + Intergenic
1035939029 8:3875435-3875457 AGTGAGATGATGTAGGTGAATGG + Intronic
1036512937 8:9417433-9417455 ACTGAGCTGCAGAAGGCCTAGGG - Intergenic
1039266191 8:35826672-35826694 AGTGTGATGCAGAACGTGCCTGG - Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1039806514 8:41004621-41004643 AGTGAGATACACTATGTGTATGG + Intergenic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1039905339 8:41782116-41782138 AGTGAGATGGAGCTGGTGTCAGG - Intronic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045562432 8:103278196-103278218 AGTAAGATGCAGAAAGCCTATGG + Intergenic
1046968718 8:120196007-120196029 GGGGAAATGCAGAAGGTGAATGG - Intronic
1048070575 8:131016722-131016744 ACAGGGATGAAGAAGGTGTAGGG + Intronic
1049322232 8:142002671-142002693 AGTGAGAAGCCGAGGGTGCAGGG + Intergenic
1051161928 9:14218476-14218498 TGTGAGACGCTGAAGGTGCATGG + Intronic
1053577134 9:39364348-39364370 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1053841638 9:42192273-42192295 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054098705 9:60923038-60923060 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054120105 9:61198667-61198689 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054587651 9:66983895-66983917 ACTGAGCTGCAGAAGGGCTAAGG + Intergenic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1055634707 9:78265037-78265059 GGTGAGAGGCAGTAGGTGTGTGG + Intronic
1056109654 9:83382482-83382504 ATTGAGACACAGAGGGTGTAAGG + Intronic
1056715769 9:89026910-89026932 AGTGAGATCCAGAAGCAATAGGG - Intronic
1056946564 9:91002658-91002680 AGTGAAAGACAGAAGCTGTAGGG + Intergenic
1057051573 9:91928075-91928097 AGTGTGATGCAGGAGGTGGCGGG - Intronic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1059663169 9:116421462-116421484 AGGGAGATGGAGAATGTGTTTGG - Intergenic
1060533377 9:124363047-124363069 ACAAAGATGGAGAAGGTGTAGGG - Intronic
1060592997 9:124831198-124831220 ATTGAGATGGAGCAGGTGTGAGG + Intergenic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1186553926 X:10536942-10536964 AGAGAGCTAGAGAAGGTGTAAGG + Intronic
1186797327 X:13059540-13059562 ATTCAGATTCAGAAGGTCTAGGG - Intergenic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1187377669 X:18770587-18770609 AGTGTGTTGCATAAGGTGGATGG + Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188410241 X:29863107-29863129 AATGAGATACAGAAAGTTTATGG - Intronic
1188484290 X:30666114-30666136 AGTGAAATGCTGCAGGTGTATGG - Intronic
1188848432 X:35102795-35102817 AGTGAGATGAAGAAGGAGCTAGG - Intergenic
1189919039 X:45885417-45885439 CATGAGATGAAGAAGGAGTATGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1191663216 X:63671514-63671536 TGTGAGAGGCAGAAGGTTGAAGG + Intronic
1192604311 X:72499015-72499037 AGAGAGAGGGAGAAGGTGTCAGG - Intronic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193854054 X:86576831-86576853 AGGGAGATGAGGAAGGTGTCAGG - Intronic
1198284263 X:135174177-135174199 TGTGAGATGGAGAAGATTTATGG - Intergenic
1199904115 X:152206913-152206935 AGTAAGATGCAGAAGAGATAAGG - Intronic
1199904203 X:152207722-152207744 AGAGTGGTGCAGAAGGTGAAGGG - Intronic