ID: 1163783581

View in Genome Browser
Species Human (GRCh38)
Location 19:19262876-19262898
Sequence GTGTATTAAAGGGGCCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783563_1163783581 22 Left 1163783563 19:19262831-19262853 CCCGGCGTCTGCCTGCAAGGGGA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 29
1163783564_1163783581 21 Left 1163783564 19:19262832-19262854 CCGGCGTCTGCCTGCAAGGGGAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 29
1163783568_1163783581 11 Left 1163783568 19:19262842-19262864 CCTGCAAGGGGAGGAGGAAGGCG 0: 1
1: 0
2: 4
3: 55
4: 452
Right 1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783581 Original CRISPR GTGTATTAAAGGGGCCGCGG GGG Intergenic
916065385 1:161132239-161132261 GGGTATTAGAGAGGCCGAGGTGG - Intronic
921020373 1:211229593-211229615 ATGTTTTAAAGGGGCCACCGTGG - Intergenic
922817058 1:228457390-228457412 GTCCATCAAAGGGGCCCCGGGGG + Exonic
923211231 1:231806289-231806311 CTGTAGTAAAAGGGCAGCGGTGG + Intronic
1088902901 11:114132001-114132023 GTGTGTGAAAGGGGGAGCGGCGG + Intronic
1103605166 12:122080509-122080531 GTTTATTCCAGGGACCGCGGCGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1106759972 13:32858656-32858678 GTGTATTAAAATGACCCCGGGGG - Intergenic
1112507090 13:99981740-99981762 GTGTATTAAAGGAGCTGCGGCGG - Intergenic
1120596486 14:86445064-86445086 GTGTTTAAAAGGGGCTTCGGGGG + Intergenic
1121577608 14:95001206-95001228 GTGTCTCCAAGGGGCAGCGGTGG + Intergenic
1135033772 16:19059686-19059708 GTGTATTAAGGGGGATGTGGTGG + Intronic
1144489908 17:15699869-15699891 GTTTGTTAAAGGGGCCTCGAGGG + Exonic
1144911054 17:18682090-18682112 GTTTGTTAAAGGGGCCTCGAGGG - Intronic
1152073040 17:78143560-78143582 ATGTGGTAAAGGGGCCACGGTGG + Intergenic
1158542034 18:58365724-58365746 GTTTATTAAAGGGGGCAAGGAGG + Intronic
1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG + Intergenic
926633863 2:15160624-15160646 GTGGATTGAAGGGGCCCTGGGGG - Intergenic
943569527 2:189556607-189556629 AAGTATTAATAGGGCCGCGGTGG - Intergenic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1170302801 20:14904868-14904890 GTGTGTTACAGGGGCCCTGGAGG - Intronic
1177145408 21:17402042-17402064 GTGTATAAAAGAGGCCTTGGAGG + Intergenic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
969362562 4:6674025-6674047 GTGTCGTAAAAGGGCCGCAGTGG + Intergenic
993520585 5:88894858-88894880 GAGTATAAAATGGGCAGCGGAGG + Intronic
1007959264 6:45943777-45943799 GTGTATTCAGGGGGCTGTGGTGG + Intronic
1018678146 6:166241050-166241072 GTGTATTGAAGGGGTGGCTGGGG - Intergenic
1019291714 7:253733-253755 GGGTATTAAAGGGGCCTCCCGGG - Intronic
1023967212 7:44969275-44969297 GTGTCTTAAAGGGGTGGGGGTGG + Intronic
1026468430 7:70674156-70674178 GTGTGCTAAAGGGGCGGTGGGGG + Intronic
1047097642 8:121641459-121641481 GTGTTTTAATAGGGCGGCGGAGG + Intergenic
1051174412 9:14348143-14348165 GTGTGTAGAATGGGCCGCGGCGG - Intronic