ID: 1163783626

View in Genome Browser
Species Human (GRCh38)
Location 19:19263127-19263149
Sequence CCAATGGACAGGTGGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783626_1163783631 -10 Left 1163783626 19:19263127-19263149 CCTGCAGGCCACCTGTCCATTGG No data
Right 1163783631 19:19263140-19263162 TGTCCATTGGGTAGTCATAGTGG No data
1163783626_1163783633 -2 Left 1163783626 19:19263127-19263149 CCTGCAGGCCACCTGTCCATTGG No data
Right 1163783633 19:19263148-19263170 GGGTAGTCATAGTGGAGTCCTGG No data
1163783626_1163783635 16 Left 1163783626 19:19263127-19263149 CCTGCAGGCCACCTGTCCATTGG No data
Right 1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783626 Original CRISPR CCAATGGACAGGTGGCCTGC AGG (reversed) Intergenic
No off target data available for this crispr