ID: 1163783630

View in Genome Browser
Species Human (GRCh38)
Location 19:19263138-19263160
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163783630_1163783635 5 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG No data
1163783630_1163783643 25 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783643 19:19263186-19263208 AGGCGCTCCCTGTGCAGGGTGGG No data
1163783630_1163783642 24 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783642 19:19263185-19263207 AAGGCGCTCCCTGTGCAGGGTGG No data
1163783630_1163783644 26 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783644 19:19263187-19263209 GGCGCTCCCTGTGCAGGGTGGGG No data
1163783630_1163783641 21 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783641 19:19263182-19263204 CCAAAGGCGCTCCCTGTGCAGGG No data
1163783630_1163783645 27 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783645 19:19263188-19263210 GCGCTCCCTGTGCAGGGTGGGGG No data
1163783630_1163783639 20 Left 1163783630 19:19263138-19263160 CCTGTCCATTGGGTAGTCATAGT No data
Right 1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163783630 Original CRISPR ACTATGACTACCCAATGGAC AGG (reversed) Intergenic